1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
3 years ago
5

Please help me I will give you the brain thing and extra points. image below part 2

Biology
2 answers:
sveticcg [70]3 years ago
5 0
The answer is c!! i know this because i know this!
Marina86 [1]3 years ago
4 0
I belive its C
Explatatiom burning something is chemical and melting something is physical.
You might be interested in
A student is instructed to record the odor of a substance after heating it in a test tube. Which is the
Grace [21]

Answer:

A Wave the fumes from the test tube toward the nose with a hand and inhale

Explanation:

4 0
2 years ago
Read 2 more answers
Where are proteins made?
WARRIOR [948]

Answer:

Proteins would be made in ribosomes.

6 0
2 years ago
Read 2 more answers
The process by which energy moves through an ecosystem can be represented by
frutty [35]

Answer:

To show the flow of energy through ecosystems, food chains are sometimes drawn as energy pyramids. Each step of the pyramid represents a different trophic level, starting with primary producers at the bottom. The width of each step represents the rate of energy flow through each trophic level.

Explanation:

3 0
3 years ago
Read 2 more answers
Hox genes are sometimes called "master switches". They have acquired this nickname because a single Hox gene will turn on (or of
Gwar [14]

Answer: B. False

Explanation:

“Hox” genes are a highly conserved group of genes, all of whose products are transcription factors bearing a specific domain (called a ”homeodomain”). The transcriptional activity of a large amount of genes relevant to embryonic development is controlled by regulatory sites which are able to bind to this domain. Changes in the transcriptional activity of even a single Hox gene may thus have dramatic downstream effects on the phenotype, as this will result in several further genes having their transcription either enhanced or suppressed.

4 0
3 years ago
Which of the following statements regarding genes is/are true?
ad-work [718]

Answer:

your but

Explanation:

hahahahaha

5 0
2 years ago
Other questions:
  • List three objects that interact with magnetic fields
    13·1 answer
  • WILL MARK BRAINLIEST!!!
    5·2 answers
  • Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    7·1 answer
  • Which is the mostly likely cause of the observed variation?
    6·1 answer
  • Which of these methods of waste management is most likely to release heavy metals and other toxins into the air?
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • 1.) When does a woman run out of eggs?
    7·1 answer
  • Grasslands are biomes that are very valuable as areas for farming and grazing livestock. In
    11·2 answers
  • Which of the following are considered gases
    7·1 answer
  • What is Aerobic Respiration ?​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!