1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
3 years ago
9

What object revolves around Earth and is made of rock? Galaxy Moon Planet Sun

Biology
2 answers:
Free_Kalibri [48]3 years ago
8 0

Answer:

moon

Explanation:

a moon is made of rock and revoles around earth

kotykmax [81]3 years ago
4 0

Answer:

moon

Explanation:

dgfgvhvhvjjfsyhchjgfhhhii

You might be interested in
Which type of molecule makes up the double layer of a cell membrane?
RUDIKE [14]
<h3>Lipid!<em> It is the closest to what i understand and it is my most researched guess!</em></h3><h3><em></em></h3>
3 0
3 years ago
Read 2 more answers
Lymph from the left arm returns to the heart through the ____ vein
Deffense [45]
The answer for the above question is Thoracic duct. 
Lymph is a clear to white fluid made of; white blood cells, especially lymphocytes, the cells that attack bacteria in the blood. It also contains a variety of substances including proteins, salts, glucose, fats, water from the blood. Unlike blood it lacks red blood cells. 
6 0
3 years ago
(20 POINTS) Of the animals in this phylogenetic tree, which two species are most closely related?
irinina [24]
It should be the human and the thesus monkey
7 0
3 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
When leaf is boiled what happens to the internal structure of plant cells?​
german

Answer:

After boiling the cell would have lost its water (dehydrated).It appears like a deflated balloon. Now it needs water to regain its original form or swell. When it is placed in hypotonic med. the water from the medium enters into the cell .Hence it regains its size. The process occurred here is called “endosmosis”. This is due to a concentration gradient of water between the medium and the cell. Excess water enters into the cell which has less water or say no water at all.

Explanation:

6 0
3 years ago
Other questions:
  • A callus is a hardening of skin, which protein is very abundant here?
    5·1 answer
  • Patellar responses often strengthen with diversion how do you explain this observation
    15·1 answer
  • The DNA sequence of a gene changed from AACTTG to AACATG. What kind of mutation occurred?
    12·2 answers
  • Alexandra jankowsky suffers from a chronic condition in which there are repeated episodes of inflammation in the rectum and larg
    11·1 answer
  • What does this animation mean when it says that ATP is like a rechargeable battery?
    15·1 answer
  • Maritime air masses form _____.
    12·2 answers
  • What does DNA stands for
    12·1 answer
  • In food chains, the flow of energy is ALWAYS _________.
    14·2 answers
  • What is the connective tissue that covers the entire outside of the bone (except the articulating surface)?
    10·2 answers
  • One important adaptation that separated us from other animals in our evolutionary trajectory is _________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!