1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
5

Cytosine makes up 24% of the nucleotides in a sample of DNA from an organism.

Biology
1 answer:
Alchen [17]3 years ago
7 0

Answer:

26%

Explanation:

if cytosine makes up 24%, then guanine also makes up 24%.

add these to get 48%.

subtract that from 100% to get a remaining 52%

then split the 52% between adenine and thymine to tell you that 26% is thymine

You might be interested in
Binary ionic compounds are named in what pattern
Andre45 [30]
Binary ionic compounds are named in the pattern of metal, then nonmetal.

I hoped this helped.
3 0
3 years ago
In which part of the plant would you expect to find cells with the most chloroplasts
Charra [1.4K]
The leaf because it is the major structure of photosynthesis in a plant.
7 0
3 years ago
Read 2 more answers
Nocturnal animals are important pollinators. What niche do they specifically fill?.
natita [175]

Answer:

Nocturnal animals are important pollinators. What niche do they specifically fill? They eat the nectars of angiosperm flowers.

Explanation:

3 0
2 years ago
Which of the following is most likely to be in observation made by an anatomist
zalisa [80]

Answer:

The nervous system is composed predominantly of neural tissue.

Explanation: Anatomist study anatomy, the study of the structure of organisms or their parts. By observing the structure of the nervous system, anatomist will tell that it is composed predominantly of neural tissue. So, he observed the structure of one part of an organism.

6 0
3 years ago
Human activities have altered many natural environments ________. Many lands are now fields where only one farm crop is grown, a
marysya [2.9K]

Human activities have altered various natural environments around the planet. Various lands are now fields where only one farm crop is cultivated, is an example of monoculture farming.  

An agricultural method of growing or producing a single plant, crop, or a livestock species, breed, or a variety in a field of the farming system at a time is known as a monoculture. Hence, the correct answer is option D, that is, monoculture.  


7 0
2 years ago
Other questions:
  • Which of these is an environmental effect of burning fossil fuels?
    6·2 answers
  • Besides changes to the amount of water, what environmental changes would
    9·1 answer
  • Do carbon dioxide organize the elements to form glucose
    7·1 answer
  • Number the steps in the correct order (1 through 5).
    5·2 answers
  • How do scientists separate the layers of the atmosphere
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which has more molecules, a mole of Silver (Ag) or a mole of tin (Sb)?
    9·1 answer
  • When scientists classify living things, they do not include viruses. This is because viruses
    12·2 answers
  • What was Robert Hooke's contribution to cells?
    12·2 answers
  • Which animal has a digestive system most similar to a human?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!