3 years ago

True or false? Do most dead organisms become fossils?

1 answer:

7 0

Only a tiny percentage of organisms becomes fossils. Soft-bodied organisms are the least likely to become fossils. Quick burial is almost always essential for remains to become fossils.

Hope this helps :)

You might be interested in

Help me please omggggg ahhhhhh

Svet_ta [14]

Answer:

Letter C would be the best possible answer choice.

Without food, the deer will starve and die, unable to reproduce new deer. The wolves will eat the dead dear but run out of deer since there are none to reproduce more.

Explanation:

- 英辞郎 <3

6 0

3 years ago

Read 2 more answers

Lipids and carbohydrates have many functions in the body of an organism. Specific lipids and proteins

g100num [7]

Answer:

D. Both store energy used by the organism.

Explanation:

5 0

3 years ago

Which characteristic of living things does a virus lack?

Marizza181 [45]

Answer:

Viruses are not made of cells as a living thing is.

Explanation:

7 0

3 years ago

Any reaction that is not intended is called

raketka [301]

The free encyclopedia. A paradoxical reaction or paradoxical effect is an effect of a chemical substance, typically a medical drug, that is opposite to what would usually be expected. An example of a paradoxical reaction is pain caused by a pain relief medication.

6 0

3 years ago

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

3 years ago