1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BlackZzzverrR [31]
3 years ago
5

Where are dangerous bacteria NOT likely to be found? a. A healthy food handler b. Raw meat and poultry c. The soil and water d.

A sanitizing solution
Biology
1 answer:
Iteru [2.4K]3 years ago
6 0
Out of the choices given, dangerous bacteria is not likely to be found in a sanitizing solution. Raw meat and poultry is guaranteed to have dangerous bacteria. 
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which phyla move by using pseudopodia?
Maksim231197 [3]

✦ ✦ ✦ Beep Boop - Blu Bot! At Your Service! Scanning Question . . . Code:  

                    Green! Letters and Variables Received! ✦ ✦ ✦

----------------------------------------------------------------------------------------------------------------

Question: Which phyla move by using pseudopodia?

--------------------------------------------------------------------------------------------------------------

  Answer: I believe the answer is Euglenophyta  

--------------------------------------------------------------------------------------------------------------

4 0
3 years ago
List two ways in which an invasive species can be introduced to a new environment.
shtirl [24]

Answer:

Hitched a ride or Humans brought it and planted it.

Explanation:

4 0
3 years ago
Read 2 more answers
Which part of the cell keeps nutrients balanced within the cell by removing waste and bringing in needed nutrients?
denis-greek [22]

Lysosomes

should be your answer

8 0
3 years ago
Which is used as evidence for the idea that multicellular organisms evolved from prokaryotes
anzhelika [568]

Living things has emerged into three domains called Archaea, bacteria, and eukaryotes. Evident that support the idea that multi cellular that is eukaryotic cell evolved from the prokaryotic cell are the descendents of the separate prokaryotic cells that together form a union which are inter dependent.

For example: The mitochondria which is referred to the energy source of the cell is considered as the great-great-great-granddaughter of a bacterium cell which is free living. This free living bacterium bacterial cell was consumed by an other cell and this remained as the stable guest in the cell. This mitochondria provided chemical energy to the cell and also protected the nutrient rich environment.  which surrounds it. This process of one organism residing in the other organism completely is called endosymbiosis.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What are the benefits of stationary weather collection? moving collection
    12·1 answer
  • The ____________ microscope uses slight differences in refractive indexes and an annular condenser to produce sharper images tha
    14·1 answer
  • Somatic cells make up all of the body tissues and organs, except gametes
    13·1 answer
  • In a forest, a tree falls on a swamp and kills the worm population reducing the population by half. The remaining population is
    10·1 answer
  • Does mitosis or meiosis occur more frequently in your body, and can you explain
    15·2 answers
  • SERE
    12·1 answer
  • Which of the following is a statistical
    8·1 answer
  • What does the prefix top mean
    12·1 answer
  • I need help with all the questions and filling out the punnet square
    7·1 answer
  • What is climate change​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!