1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dvinal [7]
3 years ago
5

Name the process through which energy is Incorporated in the ecosystem?​

Biology
1 answer:
gulaghasi [49]3 years ago
7 0

Answer:

photosynthesis

Energy enters the ecosystem via sunlight as solar energy. Primary producers (a.k.a., the first trophic level) turn that solar energy into chemical energy via photosynthesis. Common examples are land plants, photosynthetic bacteria and algae

You might be interested in
Write the function of synaps​
vekshin1

Answer:

The function of synapse is to transmit the electrical impulses from one neuron to other.

Explanation:

hope it help goodluck:)

6 0
2 years ago
Read 2 more answers
Explain the most common machine in the human body
Ilya [14]
HI there!!!!!!

It would probably be the heart, brain or our muscles; they are constantly working !

5 0
2 years ago
What characteristic of earth maintains water in the liquid state needed for life
yawa3891 [41]
There are several. there is rainwater*, glaciers, and rivers/streams.

*the rainwater I am talking about is the kind that falls from the country. no acid rain 
7 0
2 years ago
According to the theory of island biogeography, which of the following is not an island ecosystem?
den301095 [7]
<span>The correct answer is b. The open ocean. The definition of an island ecosystem does not have anything to do with water, but simply refers to an ecosystem that exists as a microcosm within a far larger, separate ecosystem. The ocean has lots of separate island ecosystems within it, but it itself cannot be referred to as one.</span>
5 0
3 years ago
A cell with a diploid number of 24 undergoes meiosis, how many chromosomes are in each daughter cell?
Musya8 [376]
12. The goal is meiosis is to reduce the number of chromosomes by half. 
3 0
2 years ago
Other questions:
  • Oceans formed when rainwater filled basins 3.8 billion years ago. ________ run into the ocean dissolving minerals like salt as t
    15·1 answer
  • Warren thinks that a fetus is a person with a right to life from the moment of conception.
    7·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • True or false? the limbic system in the brain helps to regulate emotional activities and memory.
    12·1 answer
  • How can one set of parents produce 19 children who all look different and unique but yet have some similar characteristics or tr
    5·1 answer
  • Which features form near convergent oceanic plates? Select the two correct answers.
    13·1 answer
  • The fact that each plant gets only one allele from each parent plant is detailed in the law of
    15·1 answer
  • In which step of the water cycle does most of earth’s water enter the atmosphere?
    10·2 answers
  • The photos shown below illustrate a case of synpolydactyly, a genetic abnormality characterized by two phenotypes: partially or
    13·1 answer
  • Bonus points<br>real ans plzz help<br>or I will report you​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!