1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
3 years ago
10

Which is NOT an immune component that can directly attack & destroy target cells?

Biology
1 answer:
lara31 [8.8K]3 years ago
7 0

Answer:

Macrophages are part of your innate immune system, which is antigen-independent and does not require activation.

Explanation:

Macrophages phagocytize (internalize) all non-self pathogens it encounters. These do their job without activation. Other cells in the innate immune system include basophils, neutrophils, eosinophils (these cells are polymorphonuclear leukocytes), mast cells, and dendritic cells, which act as the bridge between your innate and adaptive immune system.

All of the other entities listed above are part of your adaptive immune system. The adaptive immune system is antigen-dependent and requires activation. This section of your immune system responds differently to different pathogens, and has the bonus of having immunologic memory, the ability to remember pathogens after infection and respond much quicker upon secondary and tertiary encounters.

Note: All lymphocyte types begin as naïve cells, which then differentiate into their fully matured form upon activation.

Helper T cells are a type of CD4+ T cell that has the job of activating B and T lymphocytes. There are two different types of T helper cells: Th1 and Th2. Th1 cells secrete the cytokine interferon-gamma (IFNγ), and is primarily involved with the stimulation and activation of cytotoxic T cells, while Th2 cells secrete a variety of cytokines and are responsible for activating and assisting with B cells to make antibodies. To make a long story short, Th cells interact with APC (Antigen Presenting Cells), specifically their Class II MHC (a group of genes that present exogenous proteins). The Th cells then proliferate and gain the ability to activate these APC cells and provide the necessary signals to activate B and T cells and make them proliferate and do their specific function.

You might be interested in
RNA structure is different from DNA structure because only RNA has which of the following?
Zielflug [23.3K]
It’s b EXPLAINATION
5 0
3 years ago
Read 2 more answers
Which characteristic of life relies on the sun? A. using energy B. cell structure C. adaptation D. reproduction
blagie [28]

The sun has little or nothing to do with any of these answers except A. The sun gives plants energy, plants give animals energy, and animals give us energy. (Unless you're vegetarian in which case you skip the animal part)

7 0
3 years ago
Why would one take vitamin supplements?
oksian1 [2.3K]
Someone would take vitamin supplements to be healthy
8 0
3 years ago
HELP ASAP WILL GIVE 100 POINTS AND WILL MARK FIRST-PERSON BRAINLIEST FOR ANSWERING ALL QUESTIONS.
Ymorist [56]

Answer:

Yes the answer is

Explanation:

7 0
3 years ago
A client has discussed therapy for his hiv-positive status. what does the nurse understand is the goal of antiretroviral therapy
ElenaW [278]
The primary goal is to achieve an undetectable viral load.
The following are key treatment goals:
- maximal viral load suppression.
- Restoring and preserving the immune functions
- Prevention of transmission of the virus.
8 0
3 years ago
Other questions:
  • Which of the following is true about density and states of matter
    12·1 answer
  • How do variations affect organisms
    11·1 answer
  • The Calvin cycle functions to make organic molecules using CO2 as a source of carbon. What is the source of electrons that helps
    9·1 answer
  • The _____ tube brings a mature ovum to the uterus. fallopian ovarian Cowper
    5·1 answer
  • Which abiotic factor in tropical forests do boreal forests lacks
    15·2 answers
  • Help science!
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Help plzz timed!!! How does a bacterium's structure affect its ability to reproduce and infect?
    6·2 answers
  • Which statements besa explains the similarities between glucose and atp
    9·1 answer
  • Which step in the process of cellular respiration produces the most ATP?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!