1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
13

What has been the primary solution to problems presented by industrialization?

Biology
1 answer:
Leona [35]3 years ago
8 0
It did improve technology, but I don’t know the rest
You might be interested in
Classify the organisms based on how they obtain food.
Snezhnost [94]

everything except for the carrots, trees and the ocean picture of algae is under heterotrophs

8 0
3 years ago
Read 2 more answers
What are the four groups of macromolecules and what are their jobs in the cell?
Pepsi [2]
Each macromolecule type has its own structure and function:

Nucleic acids are DNA and RNA. ...

Proteins, which contain polymers of amino acids, provide both functional and structural functions to cells. ...

Carbohydrates provide short-term energy storage to cells. ...

Lipids, or fatty acids, provide the long-term storage.

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What movements do the quadriceps femoris muscles perform?
Anna71 [15]

Answer:

a. Extension of the lower leg

Explanation: is correct

6 0
3 years ago
HELP WILL MARK YOU BRAINLIEST!
LenKa [72]

Answer:

18:repeat the experiment again

Explanation:

Because repeating the experiment would get rid of inaccurate data

4 0
3 years ago
Read 2 more answers
Other questions:
  • The gametes of the tall plants carried a tall factor
    9·1 answer
  • Dr. X is studying how anger is related to happiness. His operational definition for anger is how often a person's eyebrows draw
    15·1 answer
  • Bena thinks that dissolving more salt in water causes the mixture’s freezing temperature to change.
    14·2 answers
  • Through which type of circulation does blood flow to your hands and feet
    5·1 answer
  • How can blood grouping be used in paternity testing
    7·1 answer
  • A student creates a Gram stain on a bacterial sample that has a mix of gram-negative and gram-positive organisms. The student ac
    7·1 answer
  • While taking a walk in a park, Muskaan observed an insect on a pitcher plant (Nepenthes). Immediately the flower opened up and t
    14·1 answer
  • 20 Points!!!! Answer ASAP!!! Describe the process of oil extraction in complete sentences. Be sure to include information about
    14·2 answers
  • Which of the following correctly summarizes the process of photosynthesis? B.2.4 *
    15·1 answer
  • PLEASE HELP WILL MARK BRAINLIEST Marie discovers boxes of elements in a storage room. The boxes do not say which elements they c
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!