1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
14

Can someone tell me if this looks ok? Here are the instructions

Biology
2 answers:
Sergeeva-Olga [200]3 years ago
4 0

Answer:

i'd recommend rereading it

Explanation:

irina [24]3 years ago
4 0

Answer:

I think it looks great!

Explanation:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which of the following is rich in organic nutrients? 
andrey2020 [161]

Answer:

Compost

Explanation:

Compost is rich in organic nutrients

4 0
3 years ago
I don't understanding this as much
algol13
I am thinking D. But I am not sure that it is the answer.
7 0
3 years ago
I’ll mark brainiest if your right need ASAP
BabaBlast [244]

Answer:

the answer is the 1st one

Explanation:

7 0
3 years ago
Read 2 more answers
The function of trna during protein synthesis is to
Lunna [17]
To deliver amino acids to their proper site during protein synthesis.
8 0
3 years ago
Other questions:
  • Imagine what it would be like to live in the enclosed space of the ISS. What do you think would personally be the biggest
    10·1 answer
  • Natural selection relates to adaptations in all the following ways except ―
    8·1 answer
  • How are fungi more like an animal
    5·1 answer
  • What is an inflammation of the connective tissue that attaches the muscles to the bones?
    9·1 answer
  • Increased activity in the sympathetic nervous system leads to _____.
    15·1 answer
  • Can a doctor be intimate with current patient
    14·1 answer
  • Which water source may become polluted as it travels over land?
    9·2 answers
  • I will give you Brainliest if you answer this problem!
    9·1 answer
  • Read the clues given below to classify an unknown organism. Clue 1: A single-celled organism with no specialized organelles Clue
    8·1 answer
  • What distinguishes the difference between DNA, chromosomes and genes
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!