1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weqwewe [10]
2 years ago
15

Which pair of structures would provide a positive identification of a plant cell under a microscope?

Biology
1 answer:
inn [45]2 years ago
7 0

Answer:

D

Explanation:

If you look under a microscope it would be easy to see the cell wall and the chloroplast. in the picture that I put you can easily see the green which is the chloroplast and the cell wall which is the thin outer layer of the cell.

You might be interested in
Chromosomal mutations usually Occur during?​
brilliants [131]

Answer:

The fundamental structure of a chromosome is subject to mutation, which will most likely occur during crossing over at meiosis.

Explanation:

4 0
2 years ago
​In human audition, the vibration of the ossicles is triggered by the vibration of the ____ and transmitted directly to the ____
goblinko [34]

In human audition, the vibration of the ossicles is triggered by the vibration of the tympanic membrane (the eardrum) and transmitted directly to the fluid and membranes of the inner ear.

The inner ear is shaped like a snail with a thousands of tiny hair cells in it and it is called the cochlea. Hair cells change the vibrations into electrical signals that are sent to the brain through the auditory nerve.


3 0
3 years ago
A rise in the Earth’s average temperature of 5 degrees would probably occur over a few
olya-2409 [2.1K]

Answer:

D Centuries

Explanation:

7 0
2 years ago
A student plants pea seeds in three identical pots. Each pot contains three seeds. The first pot
sweet [91]
The independent variable is the seeds.
3 0
3 years ago
Read 2 more answers
what can a hypothesis become if it is supported by repeated experimentation? a. a scientific theory b. an experimental group c.
Sergio [31]
A hypothesis can become A. a scientific theory if it is supported by repeated experimentation. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which elements are found in high proportion in earth's crust?
    13·1 answer
  • How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules
    6·1 answer
  • Which of the following organs would experience decreased blood flow during exercise? Which of the following organs would experie
    12·1 answer
  • What technique is used to separate the different cell parts? Select one: a. all of the above b. microscopy c. cell fractionation
    10·1 answer
  • Provide the complimentary strand of dna that would be paired with this original strand a t t c g a c g
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Why isn’t renewable energy expanding more rapidly in the U.S.?
    12·1 answer
  • If you have a mutation that is to your advantage, what could be the result?
    6·1 answer
  • Please help me I’m so confused
    9·2 answers
  • What process does the cell go into when their is a low oxygen environment?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!