1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
3 years ago
7

The following scientists made significant contributions to our understanding of the structure and function of DNA. Place the sci

entists' names in the correct chronological order, starting with the first scientist(s) to make a contribution. I. Avery, McCarty, and MacLeod II. Griffith III. Hershey and Chase IV. Watson and Crick V. Chargaff
Biology
2 answers:
Ksivusya [100]3 years ago
8 0

Answer:

Griffith, Chargaff, Avery Mc Carty and MacLeod, Hershey and Chase, Watson  and Crick,

Explanation:

Avery, McCarty and MacLeod- their famous experiment, an experimental demonstration of DNA was presented in 1944

Griffith: born in 1877. In 1928 he reported his first observation of transforming principle in bacteria.

Hershey and Chase: They conducted series of experiments in 1952 to confirm that DNA is a genetic material

Watson and Crick: Crick was born in 1916 and Watson in 1928. Their discovery of DNA as double helix structure was made in 1953

Chargaff was born in 1905. He developed two rules that led to the discocery of DNA as double helix structure

Artemon [7]3 years ago
7 0

Answer: All of the mentioned Scientist made considerable contributions to understanding the DNA molecule in the order:

Explanation: 1.Fredrick Griffith

2. Avery, McCarty and MacLeod

3.Chargaff

4.Hershey and Chase

5.Watson and Crick

You might be interested in
Describe the relationship between genetic testing and the polymerase chain reaction. How has the PCR technique made genetic test
Alex_Xolod [135]

Genetic testing is a type of medical test that identifies changes in chromosomes, genes, or proteins. (PCR) is a technique used to take a piece of DNA and make many copies of it. they can enlarge the genes to a size measurable to eye to get a closer glimpse of the gentics or dna strands.

7 0
3 years ago
A mutation that results in a single amino acid substitution in the active site of an enzyme
Nikolay [14]

Answer:

May alter the specificity for its substrate

Explanation:

The active site of an enzyme refers to the specific region of an enzyme that serves as the binding site for its one or more substrates. Binding of substrates to the active site of their enzymes is required for catalysis. Enzymes are highly specific for their substrates. Type of amino acids present in the active site of the enzymes and their interactions with substrates regulate the specificity of the enzyme. If a mutation substitutes the amino acid of the active site, it may increase or decrease the specificity of the enzyme for its substrate.

8 0
4 years ago
Read 2 more answers
The patient is an 85-year old female who presents to the emergency department (ed) with increasing shortness of breath, hypoxia,
Montano1993 [528]

The 85-year old female patient who presents to the emergency department (ed) with increasing shortness of breath, hypoxia, productive cough, and progressive weakness will be assessed and diagnosed by the nurse as someone who is probably having asthma. The mentioned symptoms are common with people who have asthma.

5 0
3 years ago
The metamorphosis of a tadpole to an adult frog involves a thorough reconstruction of the animal's body. All of the structural a
alexira [117]

The metamorphosis of a tadpole to an adult frog involves a thorough reconstruction of the animal's body. Positive feedback regulation would ensure that the animal completed its transformation.

Positive feedback regulation of prothoracic hormone secretion by ecdysteroids is the mechanism that determines the timing of metamorphosis.

Metamorphosis is the biological process by which an animal develops physically, including birth and hatching, and which involves marked and relatively rapid changes in an animal's body structure due to cell growth and differentiation.

Some insects, fish, amphibians, mollusks, crustaceans, cnidarians, echinoderms, and tunicates undergo metamorphosis, often with changes in diet and behavior.

In case of frogs, and toads, forelimbs are formed under the gill pouch, and the hind limbs are visible after a few days. This is usually followed by a longer phase in which the tadpoles are fed a vegetarian diet.

Tadpoles use a relatively long spiral intestine to digest this food. Recent studies suggest that tadpoles do not have a balanced homeostatic feedback control system until early stages of metamorphosis.

At this point, their long intestine shortens and they prefer insects.

Learn more about Positive feedback regulation here : brainly.com/question/14801112

#SPJ4

3 0
2 years ago
Please help!! Questions In Picture, giving brainiest to best answer!
Rasek [7]

1. contracts 2. increase 3. move apart 4. density 5. cool down 6. decrease 7. move closer sorry if there not correct

6 0
3 years ago
Read 2 more answers
Other questions:
  • There is a teacher from Texas that loves hairless guinea pigs. In guinea pigs, the dominant allele H codes for the trait of havi
    7·1 answer
  • BRAINLIESTTT ASAP!!
    6·1 answer
  • Function of loop of Henle is (A) conservation of water (B) formation of urine (C) filtration of blood (D) passage of urine
    13·1 answer
  • some heterozygous alleles create variations in expression so that there is not a clear dominant or recessive allele true or fals
    13·2 answers
  • When a plant produces sugars and transports them during translocation, which main plant tissues are at work?
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Cellulose differs from starch in that?
    15·1 answer
  • The eye is continuously bathed in a fluid secreted by the lacrimal gland which flows
    6·1 answer
  • Analysis and Conclusion
    8·1 answer
  • A student is comparing the cells of a prokaryote, an animal, and a plant.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!