1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
9

What level of organization is represented by each image? A: B: C:

Biology
2 answers:
Ulleksa [173]3 years ago
7 0
Answer: Tissue
A tissue is the level of organization that is shown in the image. A tissue is a group of cell, found in plants, animals and humans. The cells in the tissue are similar in structure and function. The study of tissues in the living organisms is called as histology. An organ is formed when multiple tissues are grouped togethe

Read more on Brainly.com - brainly.com/question/11761920#readmore
Rashid [163]3 years ago
6 0

Answer:

A.Cell

B. Organ

C. Tissue

Explanation:

did the test :)

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Help me !! How did i figure out what scale to write on the y-axis of my graph ? please help !!!!!
attashe74 [19]

I think you counted up and down.

7 0
3 years ago
Approximately how quickly do the Earth's crustal plates move? A. A few centimeters a year B. A few centimeters a month C. A few
aliya0001 [1]

The correct answer is - A. A few centimeters a year.

Earth's crustal plates move very slowly, between 2 cm and 5 cm (depending on the plate) annually. This is the reason why it takes millions of years for them to significantly change their position, and with it the appearance of our planet. These crustal plates are slowly moving around the planet because they are powered by flow in the interior mantle.

6 0
3 years ago
Why is it important to stain youngcultures of bacteria with<br> the grain stain?
uranmaximum [27]

Answer:

Because older cultures of gram-positive bacteria tend to lose their ability to retain crystal-violet in the peptidoglycan of their cell walls and can be confused with gram-negative bacteria.

Explanation:

Gram staining is used to differentiate between two major groups of bacteria. Gram-positive and gram-negative, these bacteria differ in the amount of peptidoglycan in their cell walls. Gram-positive bacteria have a higher amount of peptidoglycan, which absorbs the violet crystal complex used in gram staining, staining them purple/violet. Old cultures of gram-positive bacteria tend to lose the ability to retain the violet crystal and are stained by safranine, staining them red/pink and appear to be gram-negative.

8 0
4 years ago
A geologist is studying layers of rock. He finds a fossil with an imprint of one of the earliest shelled animals. According to t
ikadub [295]
I believe it would be a fossil of a reptile but I'm not a 100% sure about it. 
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the formula for cellular aerobic respiration?
    12·1 answer
  • Fungi often function as decomposers in an ecosystem. If you traced the carbon in a molecule of carbon dioxide from the air into
    12·1 answer
  • One codon specifies how many amino acids?
    9·1 answer
  • Once the sun exhausts its fuel and burns itself out, it cannot be replaced. So why is the energy from the sun considered a renew
    15·1 answer
  • Hey, if anyone’s good at genetics, I was wondering if I was correct with this question on my homework.
    12·2 answers
  • Which compound that provides energy in cells is made in every tube where cellular respiration is occuring?
    5·1 answer
  • Why do we think of wind as another form of solar energy?
    13·2 answers
  • ana walked through this part of the forest. When she passed under some low branches, water drops fell on her head. What most lik
    8·1 answer
  • A frog that is native to the rainforests of Central America is a member of the genus agalychnis. This genus is part of the hylid
    10·1 answer
  • What makes water cold
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!