1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
7

5 things I learned from the amoeba sisters biological levels in biology

Biology
2 answers:
scoray [572]3 years ago
8 0

Answer:

zenuts

Explanation:

allochka39001 [22]3 years ago
5 0

,prokaryotes and eukaryotes,  all living things have cells,some thigs that grow are not living  there are two types of cells animal cells and plant cells

You might be interested in
Which combination of atoms will form a molecule, but
dsp73

Answer:

but you did not give z

Explanation:

what is z

5 0
2 years ago
All fungi are
dezoksy [38]

Answer:

eukaryotes and heterotrophic.

Explanation:

Eukaryotes are organisms whose cells nucleus are enclosed.

Heterotrophs are organism that cannot produce its own food, instead they absorb nutrients from plant and animal remains.

5 0
3 years ago
If all grasshoppers are removed from the food chain, what will happen to the blue birds
swat32

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

7 0
3 years ago
Read 2 more answers
The members of the kingdom Protista are least similar to
Vesnalui [34]
They are least similar to bacteria

5 0
2 years ago
Imagine you have engineered a set of genes, each encoding aprotein with a pair of conflicting signal sequences that specifydiffe
Rashid [163]

Answer:

a) into the ER

b) into the ER

c) into mitochondria

Explanation:

a) This signal is located at the N-terminus of the protein and acts before the internal signal is synthesized for import into the nucleus. When the protein enters the ER, the sequence of the import signal in the nucleus cannot work because the protein would be prevented from interacting with the cytosolic receptors.

b) The signal that is imported into the peroxisome cannot function once the protein was sequestered in the ER.

c) In order for the protein to be retained in the ER, the protein must first be imported into the ER. Without there being no signal for that import of the protein into the ER, that retention signal could not work.

8 0
2 years ago
Other questions:
  • Genes located close together on the same chromosomes are referred to as
    12·1 answer
  • Which of the following is the best example of an ecosystem? A. a nest of mockingbirds, some bullfrogs, a pond, and a sandy shore
    8·2 answers
  • Which common disease is not included in the suite of diseases of copd (chronic obstructive pulmonary disease)?
    8·1 answer
  • Data must be considered valid for scientists to trust conclusions. Which is the best way to increase the validity of data in an
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of the following statements is most true regarding macromolecules and their functions?
    12·2 answers
  • During photosynthesis, plant leaves take in carbon dioxide through what in their leaves?
    6·1 answer
  • What type of services is growing strawberries?
    8·1 answer
  • What type of organism is an antlion? (Producer, Herbivore, Carnivore, Omnivore)
    5·2 answers
  • What is difference between arteriosclerosis and atherosclerosis. <br> I want clear difference.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!