1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
11

Fission is a type of asexual reproduction where a bacterium clones itself, resulting in _________ daughter bacteria.

Biology
2 answers:
klio [65]3 years ago
8 0

i think 2 is the answer if i am correct let me know

stiv31 [10]3 years ago
3 0

Answer:

perhaps two

Explanation:

In fission, there is also a term called binary fission where it produces two daughter bacteria/cells

You might be interested in
16) __________ memory holds information for 15 to 25 seconds and stores it according to its meaning rather than as mere stimulat
puteri [66]
Short-term memory holds information for 15 to 25 seconds and stores it according to its meaning rather than just as mere stimulation. However, it is not really true that short-term memory can be retained only for this short amount of time. It has been shown in different studies that it can be held even longer. 
7 0
3 years ago
The climate of the earth throughout history has always _____.
gulaghasi [49]
Flucuated between hot and cold periods
6 0
3 years ago
Read 2 more answers
Which kingdom(s) include organisms that are autotrophic or heterotrophic?
ArbitrLikvidat [17]

Answer:

Protista and Eubacteria

4 0
3 years ago
Read 2 more answers
Which wavelength in photosynthesis which has the highest amount of energy?
algol13
Violet and blue have the high frequencies (thus energy) of visible light. Red will be the least energy but lowest energy. And remember, chlorophyll is green because it reflects green into our eyes. Green is therefore not absorbed, so not used for photosynthesis.
5 0
3 years ago
Together, inhalation and exhalation are referred to as ________. together, inhalation and exhalation are referred to as ________
Gennadij [26K]
Together, inhalation and exhalation are referred to as breathing. Inhalation is the process of breathing where air moves into the lungs through the nose and the mouth. This causes an increase in the volume of air in the lungs, meaning the pressure will decrease, thus the air then moves to the lungs. Exhalation on the other hand is the flow of the breath out of an organism, for example in humans it is the movement of air from the lungs out of the airways, to the external environment during breathing. 
4 0
3 years ago
Other questions:
  • Ethyl alcohol and carbon dioxide are the end products of
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The fact that the left ventricle of the heart is thicker than the right ventricle reveals that it ________. pumps blood against
    8·1 answer
  • How does a coastline change earths surface
    13·1 answer
  • What is the general process in which molecules move from an area of higher concentration to an area of lower concentration?
    6·2 answers
  • I have taken notes on your book however I still have questions ​
    12·1 answer
  • Drag the steps into the correct order to show how plants use energy from the sun. Start with the first step on top.
    14·1 answer
  • Why does darkness affect the light-independent reactions of photosynthesis?
    11·1 answer
  • NOW!!!!!!!!!!!!
    9·1 answer
  • Trong các cây trồng sau khả năng tích lũy nh4 tốt nhất là
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!