1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
13

If a DNA sequence is A-T-G-A-C, write the sequence of base pairs that would pair with it.

Biology
1 answer:
denis23 [38]3 years ago
7 0

Answer:

T-A-C-T-G

Explanation:

Deoxyribonucleic acid, widely known as DNA, is the genetic material in living cells. It is a double-stranded molecule, with each strand arising from the pair of nucleotide monomers that forms its structure. In the DNA, four nucleotides exist namely: Adenine (A), Thymine (T), Cytosine (C), and Guanine (G).

These four bases occur in different combinations to form a sequence that makes up each strand of the DNA. However, each nucleotide pairs with one another using the COMPLEMENTARY BASE PAIRING RULE, which states that Adenine will always hydrogen bond with Thymine, while Guanine will always hydrogen bond with Cytosine i.e. A-T, G-C.

Based on the above, a DNA strand with sequence: A-T-G-A-C will pair with another DNA strand with sequence: T-A-C-T-G.

You might be interested in
How is volume, temperature, pressure and density of gas related
ollegr [7]

Boyle's law states that, at a constant temperature, the volume of a given mass of gas varies inversely with pressure. ... Thus Charles's law states that at a constant pressure, the volume of a given mass of gas is directly proportional to its (absolute) temperature. hope this helps

3 0
3 years ago
In this project, you will analyze claims about the causes of inherited genetic variation. You will then make your own claim base
lawyer [7]

Answer:

Explanation:

In the 21st century, biotechnology has developed rapidly, and the era of great health has arrived. Cell therapy has opened up new ideas for the treatment of refractory diseases in human beings and has broad application prospects. Cell biology, molecular biology, and modern immunology are the three leading modern biological sciences. Cell therapy utilizes the characteristics of certain cells with specific functions. After bioengineering or in vitro amplification and special culture treatment, these cells have therapeutic effects such as enhancing immunity, killing pathogens and tumor cells, and promoting tissue regeneration, so as to achieve the purpose of treating diseases. Techniques such as cell culture proliferation and differentiation are among the most commonly used methods in cell biology research. Since the basic laws of cell behavior are the same in vitro culture and in vivo, many studies can be performed in vitro. More importantly, people can selectively and purposefully control the environment in which cells grow, so they can study the biological behavior of cells under certain special conditions.

Assay Development Service

Genetic/epigenetic analysis service

Epigenetics refers to the regulation of epigenetic gene expression by epigenetic changes (DNA methylation, histone modifications, and non-coding RNAs such as miRNAs) that are independent of genetic sequence changes and can be genetically apparent. DNA methylation, histone modifications, and miRNAs are a reflection of changes in environmental stimuli that interact to regulate gene expression and control cellular phenotype. Massively parallel sequencing technology lays the foundation for the construction of epigenomics. Creative Biolabs provides key sequencing-based methods used in the analysis of epigenomes, including bisulfite sequencing, chromatin immunoprecipitation sequencing, 3D chromatin capture, as well as the determination of open chromatin.

In vitro assay development service

In vitro or phenotypic assays are defined as those that model some aspect of disease biology in cells or tissues derived from an experimental species or humans, which have important clinical implications for disease progression and treatment. In vitro assays have the following benefits: obtaining direct knowledge related to the potential new disease background; multiple compounds with different modes of action can be tested, and depending on the throughput of the assay, within a certain range; it provides data support for more complex phenotypes or subsequent assessments or in vivo trials. The examples given in the various disease areas use a wide range of cell-based assay types, typically in 96-well formats, which differ markedly in their outcome when compared to, for example, biochemical or in vivo assays.

Assay Development Service

In vivo assay development service

The experimental animals themselves are studied for their breeding, biological characteristics and information, new varieties cultivation and disease diagnosis, treatment, and prevention to achieve people's purposes. Taking animals as a model, some experiments are carried out in vivo to study the reactions, manifestations and developmental rules of animals, and lay the foundation for solving complex diseases of human beings. The services of in vivo assay include assessing the phenotypic characteristics of transgenic lines, functional MRI services for awakening animals to visualize neural networks, and assessing transporter activity and building animal models, etc.

7 0
3 years ago
Can someone please help me with this question
Talja [164]

Um. Yes? The braij is responsible for the nervous system.

5 0
3 years ago
Why would it be easier for a doctor to tell that someone has a viral infection when the virus is in the
Mashutka [201]

Answer: doctor may be able to determine the cause by listening to your medical history and doing a physical exam. If necessary, they also can order a blood or urine test to help confirm a diagnosis, or a "culture test" of tissue to identify bacteria or viruses.

Explanation:

5 0
2 years ago
Where does the second, major part of cellular respiration take place
noname [10]

Answer:

The answer is mitochondira of heterotoph cells

Explanation:

4 0
1 year ago
Other questions:
  • The money used in Jordan is called the Dinar. The exchange rate is $3 to 2 Dinars. Find how many dollars you would receive if yo
    14·1 answer
  • One way the immune system fights pathogens
    14·2 answers
  • The hippocampus, amygdala, and hypothalamus are part of the
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Mosses are classified as bryophytes. Which best describes mosses?
    13·2 answers
  • During which eon did oxygen begin to build up the most in Earth’s atmosphere?
    10·1 answer
  • Organisms which "hold an ecosystem together" because they have a significant role to play are called
    7·1 answer
  • How will the temperature inside the car feel?
    8·1 answer
  • Please help I will give brainalist
    9·1 answer
  • 5. Which is a common food allergen?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!