1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
15

All you need is on the photo

Biology
2 answers:
lutik1710 [3]3 years ago
5 0

Answer:

B Cellular Respiration

Explanation:

In Cellular Respiration organisms use Oxygen and give out Carbon dioxide.

In Photosynthesis plants use Carbon dioxide and give out Oxygen.

Alex_Xolod [135]3 years ago
3 0

Answer:

B

Explanation:

photosynthesis takes in CO2 and gives O2, so if it were photosynthesis the lines would be swapped. cellular respiration takes in O2 and expels CO2.

You might be interested in
If a plant were to absorb a substance that inhibits the light reactions, the
Valentin [98]

B continue to produce oxygen

Explanation:

carbon will not reduce to synthesise sugars

8 0
3 years ago
Why is homeostasis important to the human body?
sergiy2304 [10]
Homeostasis is a tool that your body uses to keep things in balance. Such as your body temperature. Too hot, you start to sweat. (which cools you down as it evaporates) And when you're too cold, your body starts to shiver, effectively warming you up by making your body move rapidly.
8 0
3 years ago
Can anyone solve this
mestny [16]
A habitat, Is the physical area where an organism lives.
3 0
2 years ago
Assume that you touch poison sumac and still have not developed a rash 12 hours later. Can you safely assume you are not allergi
katrin2010 [14]
The first time you get poison sumac, it usually takes a while to show up. If you have had it before, it takes around a day or two if you have had it before, so I'd say the answer to the question is no.
7 0
3 years ago
Which are the only invertebrates that can fly?
ExtremeBDS [4]
Your answer would A insects because insects are the only invertebrates that can maintain flight. FOr example Butterflies and Flies Can maintain flight
Hope this has helped :)<span />
3 0
3 years ago
Read 2 more answers
Other questions:
  • What fluid, with a very high osmolarity, was used in part 2 of the paper chromatography experiment? why is this important? why i
    9·1 answer
  • Which material is not found in endoskeletons?
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Prior to meiosis during which stage of the cell cycle does dna replication occur
    14·1 answer
  • Ratings that are not completely accurate are known as ____.
    13·1 answer
  • What part of dna stores the genetic code
    15·1 answer
  • An animal inherits a mutation in a gene that produces dark pigment proteins that are expressed in the animal’s skin tissue. If
    7·1 answer
  • How much does a 200kg car weigh
    7·2 answers
  • **anatomy &amp; physiology question**
    11·1 answer
  • 68 paramecia are found in an area measuring 2 cm x 3 cm. _____ paramecia/cm2 *
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!