1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
7

A species of butterfly lives in a warm climate. The butterflies feed on the nectar of tropical flowers. Birds eat the butterflie

s, and they prefer to eat the butterflies with brighter wings.
What would most likely cause this species to become extinct?
Biology
1 answer:
kirill115 [55]3 years ago
3 0

Answer:

You didn't give options to choose from so I'll just wing it.

Over-predation will most likely be the cause of the extinction of the butterflies

Explanation:

Since the birds are preying on them, their population will most likely go extinct because of the birds.

You might be interested in
Which of the following do protists NOT have?
creativ13 [48]

Answer:

you didnt put the choices, give me the choices and I can tell you

Explanation:

8 0
3 years ago
Theories basic to all of the life sciences include the
Natali [406]
Theories basic to all of the life sciences include the cell theory because all living things are made up of cells.
8 0
3 years ago
Tatiana went outside at 8:00 pm to feed her dog Rufus. She decided to sit outside with Rufus as he ate so she turned on the porc
Molodets [167]
The insects clustered around the light is an example of A response to a stimulus. The insects are attracted to the light, so the flocked towards it.
7 0
3 years ago
Read 2 more answers
What caused the End Ordovician extinction
attashe74 [19]

Answer:

the first wave of extinction may be related to rapid cooling at the end of the Ordovician Period, and the second phase is widely regarded as having been caused by the sea-level fall associated with the glaciation.

5 0
3 years ago
Visual Check
aksik [14]

Answer:

They should all have purple flowers.

Explanation:

This is because plants use the reproduction called mitosis, which means that the child will be a direct copy of the parent.

Hope this helps! :)

8 0
3 years ago
Other questions:
  • Intestinal virome changes precede autoimmunity in type i diabetes-susceptible children. 2017. proc natl acad sci u s
    7·1 answer
  • Sand dollars typically live in the intertidal zone. Which adaptation do sand dollars most likely have?
    5·2 answers
  • How do you calculate a scale for your drawing when using a microscope?
    11·1 answer
  • Fever is an innate response to cellular injury and is initiated when pyrogens are released from damaged cells or certain bacteri
    5·1 answer
  • The gradual change in an ecosystem in response to environmental change is called succession. From what you have learned, how is
    15·2 answers
  • How is the land and soil qality affected by sediment loss
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How are growth and development dinstinct from each other
    9·1 answer
  • Which hazard is most threatening and why?​
    10·1 answer
  • Help please!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!