1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin [286]
3 years ago
8

What environment would be least likely to grow bacteria and why? Here are your choices:

Biology
1 answer:
storchak [24]3 years ago
3 0

Answer:

3.

Explanation:

A classroom desktop is the least likely to grow bacteria because it is a relatively clean surface. The armpit of a human and a warm freshwater mud puddle are a more suitable habitat for bacteria because they are warm, and provide a relatively safe environment for them

You might be interested in
South america obtains most of its caffeine from the seeds of this plant
Paraphin [41]
<span>Guarana i think but i'm not very sure</span>
4 0
3 years ago
Water is warmed by the sun and
defon
And cooled by night...
7 0
3 years ago
Think about challenges related to marine science which are currently facing society. In coastal and inland communities alike, th
Alex_Xolod [135]

Global challenges related to marine science are as follows:

1. Ocean acidification is a major issue that affects all of the world's ocean industries and has severe negative effects on the environment, society, and the economy. Coordinated government action is required to effectively address this issue.

<h3>What is impact of ocean acidification?</h3>

Ocean acidification will affect the biological, biogeochemical, and ecological aspects of the oceans, and while the effects on the environment, the socio-ecological system, and human dimensions are all still not fully understood, they have the potential to have very dramatic effects. Numerous marine ecosystem services and goods may be impacted directly or indirectly. Industries that rely on these services from the Ocean are impacted.

2. Overfishing:

Overfishing poses a severe threat to the fish in our water, whether it's for the food industry or the aquarium sector. The Food and Agriculture Organization estimates that more than half of the species of marine fish have been totally or overexploited, despite the fact that many of them simply need to remain in the sea because they are not necessary for food security or because they cannot survive in captivity. We are killing entire ecosystems and the food chains that are necessary to keep them healthy by overfishing. Overfishing not only causes the extinction of entire species, but it also directly affects other species in the food chain.

3. Plastic

Between 1.15 and 2.41 million tons of plastic enter the ocean every single year. The Great Pacific Garbage Patch, which is a collection of rubbish in the Pacific Ocean is now three times the size of France. Animals can get tangled in the huge amount of plastic which litter the ocean, and the plastic smothers and destroys coral and sponges. Plastic bags are also often mistaken for food by sea turtles, and they either become trapped or eat the bag which clogs their digestive system. Plastic continuously breaks down resulting in little pieces of “micro-plastic” that are consumed by a variety of marine life, including several species that humans like to catch and eat.

solutions that account for societal needs and wants:

1. Cutting back on carbon emissions.

2. Reducing plastic usage.

3. Making sure the fish you consume is supplied sustainably and ethically.

4. Participating in beach cleanups.

5. Only purchase aquarium fish that were raised in captivity.

6. Supporting elected officials that favor a wholesome atmosphere

7. Contributing to environmental organizations that protect our oceans.

For more information regarding ocean acidification, visit:

brainly.com/question/7604502

#SPJ1

8 0
2 years ago
To get rid of waste generated by thousands of sailors aboard each of its aircraft carriers, the US Navy is using a process calle
Crank

Answer:

Its location.

Explanation:

The main difference between pyrogenesis and setting garbage on fire in a landfill is that pyrogenesis process occurs on the surface whereas garbage on fire in a landfill occurs inside the soil at certain depth. Pyrogenesis is an extreme thermal process that converts organic matter into gas made up of hydrogen and oxygen whereas garbage on fire in a landfill decomposes garbage that breaks down materials in simpler substances.

6 0
3 years ago
What does the word photosynthesis mean?
kondor19780726 [428]

when a plant takes in sunlight to make glucose

8 0
3 years ago
Read 2 more answers
Other questions:
  • The most common way of restraining dairy cows is with?
    12·2 answers
  • What type of reactions build proteins from amino acids??????????
    9·1 answer
  • DNA, RNA, and starch: What do these three important biomolecules have in common? A) They all contain at least one carboxyl group
    9·2 answers
  • What type of relationship would a mouse and a rabbit have?
    8·2 answers
  • A person who is homozygous for the x chromosome is
    5·1 answer
  • What happens to food energy during photosynthesis? during cellular respiration??
    11·1 answer
  • 5. The cells that function with the sieve tubes are the
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the basic function of rna
    12·1 answer
  • The primary site of photosynthesis<br> fruits<br> roots<br> leaves<br> flowers
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!