1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
9

The nurse is teaching a client, gravida 1 para 0, at 8 weeks gestation about expected weight gain in pregnancy. The client's pre

pregnancy BMI is 21 kg/m2. Which statement made by the client INDICATES an understanding about weight gain?
1. "I should gain 10-15 lb during the first trimester"
2. "I should gain a total of about 30 lb during my pregnancy."
3. "I should gain no more than 0.5 lb per week during the third trimester."
4. "If I gain <20 lb during pregnancy, it will be easier to lose weight postpartum."
Biology
1 answer:
matrenka [14]3 years ago
6 0

Answer:

2. "I should gain a total of about 30 lb during my pregnancy."

Explanation:

"I should gain a total of about 30 lb (13.6 kg) during my pregnancy." [which is 65%]

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which are the very small particles that make up matter? atoms molecules mass weight
andre [41]

Answer:

The awnser is atoms

Explanation:

Atoms are the building blocks of everything.

5 0
3 years ago
Which of these is not a natural earth cycle?<br> rock<br> water<br> carbon<br> oil
Andrei [34K]

Answer:

The answer is oil .

Explanation:

<u>Oil</u> is not a natural Earth cycle.

(Correct me if I am wrong)

4 0
2 years ago
Which of the following is a type of volcano? 1. Dome 2. Flat 3. Block 4. Cinder
Sedaia [141]
4. Cinder cones are a volcano
6 0
2 years ago
Homologous chromosomes are separated.
ExtremeBDS [4]

Answer: I'm not exactly sure what your asking but here's my answer: Homologous chromosomes are separated during anaphase of meiosis I.

7 0
2 years ago
Other questions:
  • Which of the following reactions is used to radioactively label DNA?
    7·2 answers
  • Which step involves water changing from a liquid to a gas​
    6·2 answers
  • How are rain forests related to wind patterns?
    11·1 answer
  • Which type of RNA functions as the crust copy of the genetic code
    10·1 answer
  • Please help ASAP! I'll give brainliest and 50 points if you have a great answer.
    13·2 answers
  • A school’s environmental club wants to reduce the ecological footprint that the student body creates annually. Which step would
    12·1 answer
  • Pls answerrrrr guys. i need the answer. if u answer i will mark u as brainliest and follow u too
    15·1 answer
  • What is the fitness of an organism?
    6·1 answer
  • What kind of rock is shown in the picture ? <br> How do you know what type of rock it is ?
    15·2 answers
  • Channel between the middle ear and the nasopharynx.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!