1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
2 years ago
6

21. The diagram below represents a sequence of events that occurs in living things.

Biology
1 answer:
Sladkaya [172]2 years ago
8 0

Answer: b

Explanation:

All the smaller molecules are made up of the organic elements

You might be interested in
Give a well detailed explanation of the given topic. Attach diagrams if possible.
Anna71 [15]
<h2>Hey There!</h2><h2>_____________________________________</h2><h2>Answer:</h2><h2>_____________________________________</h2>

Class Crustacea belongs to the Phylum Arthropoda. It is a class itself thus it does not have any subphylum.

<h2>_____________________________________ </h2>

\huge\textbf{Phylum Arthropoda}

Phylums are the groups and Phylum arthropoda is one of the 33 phylas of the Kingdom Animalia. Phylum Arthropoda has the largest phylum of the Animal Kingdom with variety of animals that include one million species. It has 5 classes.

  • Class Merostomata
  • Class Arachnida
  • Class Crustacea
  • Class Myriapoda
  • Class Insecta
<h2>_____________________________________</h2>

\huge\textbf{Class Crustacea}

  • They are usually aquatic both marine and freshwater.
  • Exoskeleton is hard and made up of chitin called carapace.
  • Body is divisible into head, thorax and abdomen. Some animals have cephalothorax.
  • Cephalothorax regions are formed by the fusion of head and thorax
  • Head bears two pairs of antenna, one pair of mandible, two compound eyes with stalk.
  • Respiration takes place by gills or through body surface
  • Excretion is carried out by one pair of antennary glands or green glands.
  • The thorax and abdomenal appendages may be modified for swimming, feeding, walking, resperation as well as reproduction.
  • Sexes are separate
  • Dimorphism is prominent
  • Five walking legs for locomotion are present.
  • Example: 1)free living are, Daphnia, Cyclops, Argulus, Sacculina, Prawn Crabs etc.

                        2)Parasite are, Barnacles and Sacculina.

                        3) Marine are Shrimps, Lobsters etc.

                        4) Sedentary crustaceans are Barnacle(Parasite), Prawns(Fresh-water living) etc.

<h2>_____________________________________</h2><h2>Best Regards,</h2><h2>'Borz'</h2><h2 />
7 0
3 years ago
Which is a commercial use for lactic acid fermentation
Andreas93 [3]
To make foods such as bread, yoghurt and cheese.
3 0
3 years ago
Which object is created during the formation of a star?
yan [13]

Answer:

i think it's protostar

Explanation:

........

3 0
3 years ago
Read 2 more answers
What is cell division?
frozen [14]

Answer:

cell division is the process by which a living cell proliferates from one cell to two cells.

I hope this helps

7 0
3 years ago
Read 2 more answers
Arrange the phases of mitosis in the correct order.
JulsSmile [24]
1. Chromosome condense (Prophase)
2. Spindle fibers form (Prophase)
3. Chromosomes allign in the center of the cell (Metaphase)
4. Chromosomes separate (Anaphase)
5. Cell membrane pinches (Telophase and Cytokenesis)
6. Spindle fibers disappear (Conclusion of Cytokenesis)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Consider the following planned experiment​
    8·2 answers
  • What is the name of the force that exists between molecules<br> I
    10·1 answer
  • What three continents does the tropic of cancer pass through?
    8·1 answer
  • Pasteur used swan-neck flasks in his experiments to test the validity of spontaneous generation. Suppose that after allowing the
    12·1 answer
  • Which of the following structures is not a component of a photosystem?
    7·1 answer
  • The cowbird is a nest parasite that lays its eggs in the nests of other species in the trees along the boundaries of forests and
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Index fossils come from types of organisms that lived during only a relatively short period of time, were abundant, and
    14·1 answer
  • active transport moves mineral ions into root hair cells through cell membrane proteins. Explain how protein molecules move ions
    13·1 answer
  • How will genome projects contribute to better productivity in cattle?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!