1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shtirl [24]
3 years ago
10

An inhibitory stimulus has occurred. B. Chemically gated potassium channels have opened. C. Excessive potassium has diffused out

causing hyperpolarization. D. Excessive depolarization of the axon has occurred.

Biology
1 answer:
andrezito [222]3 years ago
7 0

Given question is incomplete. Complete question has been attached.

Answer:

C. Excessive potassium has diffused out causing hyperpolarization.

Explanation:

The nerve action potential can be divided into following stages:

  • Stimulus is detected by the cell in resting stage.
  • Sodium channels in the membrane open from where influx of sodium ions occur which is called depolarization
  • After a while, sodium channels close and potassium channels open from where efflux of potassium ions occur which is called repolarization.
  • The membrane potential further lowers due to continous efflux of potassium ions which is called hyperpolarization.
  • After a while potassium channels close and membrane returns to its resting stage.

In the given figure, stage 4 depicts hyperpolarization because the membrane potential has dropped to the lowest point below -70mV. Hence, option C is correct.

You might be interested in
If the population of rats in your community is doubled, what effect would
salantis [7]

Answer:

The community would be out of resources

Explanation:

the doubling of the rat would surely affect the resources of the community.

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which of the following statements is true?
zmey [24]

The answer to the question is A

8 0
3 years ago
Read 2 more answers
The North Atlantic right whale migrates between subtropical and polar waters annually. Nearly 50 percent of right whale deaths a
Mekhanik [1.2K]
Sonar testing has caused whales to die in mass amounts.
8 0
1 year ago
What percentage of genetic material is the same in everyone?
nika2105 [10]
The answer is 99.9 percent.
8 0
3 years ago
Other questions:
  • Which option identifies one section of the ocean floor?
    14·2 answers
  • What are the possible genotypes of the gametes?
    8·1 answer
  • If a lung were to be found in a mollusk, where would it be located
    14·1 answer
  • Open dumping in landfills was outlawed in many states because of _____.
    10·2 answers
  • This is an organism exhibiting characteristics similar to one known to be dangerous, is called?
    12·1 answer
  • Term Definition
    9·2 answers
  • What type of mutation has the least amount of impact on a protein ?
    13·2 answers
  • Neutral atoms have equal amounts of protons and electrons <br><br> true or false
    15·1 answer
  • What would happen to a plant if the amount of carbon dioxide in the air suddenly decreased?
    7·1 answer
  • A blue-eyed myopic woman from a marriage with a brown-eyed man with normal vision gave birth to a brown-
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!