1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
14

Soil Texture Triangle (Need answers asap)

Biology
1 answer:
bekas [8.4K]3 years ago
8 0
I don’t know the answer but I think you should guess!
You might be interested in
Energy required by the cell is generated in the form of ATP. ATP is hydrolyzed to power many of the cellular processes, increasi
grin007 [14]

Answer: Option B) allosteric activation

Energy required by the cell is generated in the form of ATP. ATP is hydrolyzed to power many of the cellular processes, increasing the pool of ADP. As the relative amount of ADP molecules increases, they can bind to glycolytic enzymes, which will lead to the production of more ATP. The best way to describe this mechanism of regulation is allosteric activation

Explanation:

Some enzymes have more than one active site. The other site(s) is called allosteric site.

In this case, ADP released from the glycolytic reactions binds to the allosteric sites of glycolytic enzymes, activating them and causing further breakdown of glucose, hence ATP continues to be generated.

ATP + H2O ---> ADP + Pi + free energy

8 0
4 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Which of the following is not a function of Carbohydrates in your cells?
qaws [65]
Please upload a picture so I can answer the question.
5 0
3 years ago
Specialized skin cells that can trigger an immune response are called:
ankoles [38]

Answer:

D. Langerhans

Explanation:

edge 2020

7 0
4 years ago
Which client would a nurse monitor most closely for postoperative respiratory complications? a 55-year-old client with a history
likoan [24]
A 55 year old client with a history of asthma who had a colon resection. :)
6 0
3 years ago
Other questions:
  • Brad is swimming in the ocean on a hot sunny day. He finds the water to be much colder than the sand on the beach, even though t
    6·2 answers
  • Suppose a sperm cell with the normal haploid number of chromosomes fertilizes an egg cell that does not have the normal haploid
    10·1 answer
  • What two amino acids are coded for by an mRNA segment reading CUA AGG
    12·1 answer
  • what do some of your cells do to keep facilitated diffussion operating while transferring glucose into the cell?
    15·2 answers
  • Perquè dos dies després de la ovulació la dona ja no es fèrtil
    11·1 answer
  • Which best describes how air moves during convection?
    8·2 answers
  • PLEASE HELP! THIS IS VERY IMPORTANT!
    11·1 answer
  • wrist drop results in an inability to extend the hand at the wrist. which nerve would most likely be affected in this injury
    10·1 answer
  • Select the correct answer.
    5·2 answers
  • According to Gerhard Lenski, human societies undergo a process of change characterized by a dominant pattern known as
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!