1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
5

Scientists can use mutants to study metabolic pathways. These organisms have a mutation in a gene encoding a metabolic pathway e

nzyme that results in the inactivation of that enzyme. Saccharomyces cerevisiae (a yeast species) mutants are available that grow on fructose, but not glucose. This growth defect results from a mutation in the gene encoding what enzyme?
Biology
1 answer:
VashaNatasha [74]3 years ago
3 0

Answer:

jlgd7trus576s6rdyird

Explanation:

You might be interested in
Animals behave in order to satisfy ___ needs.
yanalaym [24]
Every animal, plant and human needs the primary <u>physiological </u>needs of water, food and shelter provided by the abiotic system.    

Organisms in the ecosystem are interdependent.<span> Ecosystem is encompassing all the life on earth in the physical environment that supports it. In addition, </span><span>an ecosystem involves both the biological (plants, animals, human beings) and non-biological (land, water, soil, and atmosphere) community which interacts as a system. More importantly, the living things are very dependent on the abiotic community since it cannot survive by itself. </span>
5 0
3 years ago
Read 2 more answers
Help me pls fast
scoundrel [369]
X, answer is X, good luck now, pls answer my question pls pls.
8 0
2 years ago
What are the two primary sources of energy for the earth
Lena [83]
The sun and isotopes
3 0
4 years ago
Read 2 more answers
Which of the following biotechnologies is defined as the intentional reproduction of individuals in a population that have a par
Scilla [17]

Answer:

cloning I think mate

Explanation:

thanks

6 0
3 years ago
The prefix auto- means “self.” The root word troph comes from a Greek word that means “to feed.” How could knowledge of these wo
yKpoI14uk [10]

autotroph would mean to self feed or you are are capable of feeding yourself

4 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • there are distinct differences and similarities between prokaryotes and eukaryotes; the similarities are
    5·1 answer
  • What is the relationship between organelles, cells, tissues, organs, and organ systems?
    8·1 answer
  • Lithium has 3 electrons. why do 2 electrons go in the first shell, and one in the second?
    14·1 answer
  • Please please help ASAP
    5·1 answer
  • What substances are returned to the blood before it leaves the kidneys?​
    12·1 answer
  • What is the correct answer???
    8·2 answers
  • 50 POINTS!!!! Which result is a predicted result of the melting of the world's ice sheets?
    13·1 answer
  • You may assume the Sickle Cell locus is in Hardy Weinberg equilibrium. Also, the term carrier implies that the person has a part
    10·1 answer
  • What type of questions does developmental biology address?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!