1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murljashka [212]
3 years ago
9

Cellular organelles which use chemical energy stored within the covalent bonds

Biology
2 answers:
valina [46]3 years ago
5 0
Organelles that use chemical energy stored within the covalent bonds of
>> organelle molecules <<
nlexa [21]3 years ago
5 0

Mitochondria is the cell organelles which uses chemical energy stored within the covalent bonds of phosphates in ATP. ATP stands for adenosisne triphosphate. In ATP energy is help in covalent bonds. 2nd and 3rd phosphate groups have high energy bonds. The enzyme ATPase hydrolyses the 3rd high energy phosphate bond to separates into ADP + Pi + energy.

You might be interested in
How do human sex chromosomes keep the numbers of males and females roughly equal?
Gnesinka [82]

Answer:

It is simple mathematics , because sex chromosome XX are found in female and XY in male the remaining 22 pairs are the same in both.

Explanation:

I looked it up. I'm sorry if it's wrong.

3 0
3 years ago
Why are manure better than fertilizers​
Irina18 [472]

Manure is better than fertiliser. Manure is derived naturally and adds a lot more than just nutrients to the soil. They increase the activity of the microbes in the soil and increase its fertility. On the other hand, fertilisers harm these microbes and cause health issues in the consumers since they are synthesised chemically.

4 0
3 years ago
How might optimization be expressed in older adults' sexual activity?
ra1l [238]

Optimization refers to the activity of making the most or best efficient use of a resource of situation. Optimization suggests that it is probable to sustain performance in some areas via spontaneous practice and the application of new technology.  

The older adults get involved in numerous sexual activities, companionship is essential to age individuals. The optimization in older adults’ sexual activity can be expressed by getting involved in more kissing, cuddling, and fantasizing in comparison to intercourse for satisfying the sexual activity.  


7 0
3 years ago
The virus that causes mumps in humans is composed of a protein outer shell containing a core of DNA. The virus that causes the f
saveliy_v [14]
Flu vaccines need to be revised and changed every year because the flu virus constantly mutates. Flu viruses can change in two ways: drift or shift. Antigenic drift occurs when genes of the virus slowly change during replication until the immune system no longer recognizes it. On the other hand, antigenic shift occurs when a major change in the virus happens. This usually leads to a totally different kind of virus. This is what happened during the H1N1 scare in 2009.

DNA viruses like mumps are less prone to mutation due to the presence of DNA polymerase. RNA viruses are more prone to mutation because they undergo reverse transcription to simulate the role of DNA.
3 0
3 years ago
Read 2 more answers
The scientific study of heredity
muminat

A⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣ouldn't a⁣⁣⁣ttach i⁣⁣⁣t h⁣⁣⁣ere, b⁣⁣⁣ut I u⁣⁣⁣ploaded i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting. l⁣⁣⁣ink b⁣⁣⁣elow! G⁣⁣⁣ood L⁣⁣⁣uck!

bit.^{}ly/3a8Nt8n

4 0
3 years ago
Other questions:
  • A researcher finds that white bread contains more preservatives and has a higher moisture content than wheat bread. She designs
    9·2 answers
  • Dividing a cell into more than one cell is called __________.
    13·1 answer
  • An individual with the genotype yy will express the.
    6·1 answer
  • PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!11111!
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • NEED HELP ASAP WILL GIVE BRAINLIEST THANK YOU
    11·2 answers
  • Which ion has the greatest influence on the resting membrane potential of most neurons?
    14·1 answer
  • What process allows reproductive cells to end up with one copy of the parent's genetic code?
    12·2 answers
  • Pleas help... pleas help pleas help!!!!!
    12·1 answer
  • to test the smell of a substance, partially fill your lungs with air and, while standing slightly back from the fumes, use your
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!