Answer: USDA registration for research institute.
Explanation:
United States Department of Agriculture ( USDA) is a federal agency in the United States which was founded by Abraham Lincoln. This agency plays a major role in the regulation and maintenance of farming, ranching, and forestry industries, as well as regulating aspects of food quality & safety. The agencies established under the USDA includes:
--> Agricultural research services
--> Farm service agency and
--> Animal and Plant health inspection service.
Through the Animal and Plant inspection services, the USDA administers the Animal Welfare Act (AWA) which purposefully excluded laboratory strains of rats and mice because they are breed specifically for research purposes.
Answer:
I think this is the list right? - Felis catus Sylvilagus audubonii Parus inornatus Euarctos americanus
Explanation:
When two members of the same species (male and female) mate, they produce fertile offspring.
The conclusion that can be drawn from this is that due to the fact that from looking at the scientific names of the animals, there are different genus and species names, there would be no interbreeding between them as they do not belong to the same species.
And if peradventure there is crossbreeding, the union would be unable to produce fertile offspring.
Answer:
36750J
Explanation:
Potential energy, which is the energy of a body at rest or in a position is calculated as follows;
P.E = m × g × h
Where;
m = mass (kg)
g = acceleration due to gravity = 9.8m/s²
h = height of the boulder (m)
According to the provided information;
m = 25kg, h = 150m
Using P.E = m.g.h
P.E = 25 × 9.8 × 150
P.E = 36750 Joules
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.
