Glycolysis is the breakdown of metabolic materials into energy and pyruvic acid. it is supported by me because without energy we wouldn't be able to do anything and almost every thing we do requires energy from taking a walk down to the pumping of blood by the heart throughout the body
<span>Adopt ecological conservation practices :)</span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Because the common cold is cause by a ‘virus’.......
The answer is VIRUS
Answer:
Millions of years ago, the Appalachians were taller than the Himalayas! Millions of years of erosion, however, have taken their toll. ... The crust that is now the Appalachians began folding over 300 million years ago, when the North American and African continental plates collided.
