1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
3 years ago
14

A group of scientists is studying a protist species.

Biology
1 answer:
Basile [38]3 years ago
5 0

Answer:

Hello, Your answer is B) They will reclassify the species in the phylum Phaeophyta.

Explanation:

The species is currently classified in the phylum Chrysophyta because of its physical characteristics. However, after the scientists analyze the species' DNA, they discover that the DNA is most similar to protists in the phylum Phaeophyta. Since the phylogenetic trees are mostly made on the basis of the similarity of the DNA to the DNAs of the species present in a phylum, the species will get reclassified into the Phaeophyta phylum. <em>Hope That Helps!</em>

You might be interested in
Which of the following terms describes all of the non-living components of an ecosystem
Svet_ta [14]

Abiotic: which are the non-living factors and chemicals in environments which can affect the ecosystem.

6 0
3 years ago
Read 2 more answers
Heyo friends I'm new here
Tomtit [17]

Answer:  The atmosphere prevents the sudden increase in temperature during the daylight hours. And during the night, it slows down the escape of heat into outer space The atmosphere keeps the average temperature of the Earth fairly steady during the day and even during the course of the whole year.

7 0
3 years ago
Read 2 more answers
Diagram of breasts...​
Mumz [18]

Answer:

diagram of breasts

Explanation:

3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which is the herbivore
AleksandrR [38]

Answer:

A herbivore is an animal that eats only plants. The animal has special teeth that are normally flat used just for their adaptation to eating the plants.

Explanation:

the way I remember this is the word <em>herb</em> reminds me of a plant

4 0
3 years ago
Other questions:
  • How do elements get into our body?
    11·2 answers
  • MARK AS BRAINLIEST!!!
    5·2 answers
  • Which of the following microscopes has the lowest resolution
    13·1 answer
  • What two things do scientists use to study the evolutionary trends in vertebrates​
    14·1 answer
  • A sustained muscle contraction is referred to as what ?
    6·1 answer
  • Why is the food wetted in the mouth?​
    12·2 answers
  • Which of the following statements is true about the scientific process?
    12·1 answer
  • What's the relationship between macromolecules, polymers, and monomers?
    6·1 answer
  • The chromosomes in the nucleus of a cell contain a code known as_______.
    14·2 answers
  • Cystitis is most often caused by Group of answer choices Escherichia coli. Leptospira interrogans. Candida albicans. Neisseria g
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!