1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
11

Where are hotspots located?

Biology
1 answer:
Diano4ka-milaya [45]3 years ago
6 0

Answer: i would say the core then its the mantle then the crust

Explanation: hope this helps

You might be interested in
Aiden is a 4 month old baby boy. when he was born his mother decided to breast feed him, instead of using formula. what type of
Alex73 [517]
<span>Actually baby Aiden will surely develop a strong secretory Iga antibodies which is passive immunity to most of the types of bacteria and viruses, ie, as a protection against infections, which inturn is a response to the baby to its immune system in the form active immunity.</span>
7 0
4 years ago
Read 2 more answers
Which is a function of mucus in the lungs?
Shkiper50 [21]

Hello There!

<u><em>The "Lungs" are pairs of organs within the rib cage.</em></u>

<u><em></em></u>

<u><em>In the "Lungs" the mucus traps dust and pollen</em></u>

6 0
3 years ago
Read 2 more answers
HELPPPPP LOTS OF POINTS
ZanzabumX [31]

Answer:

B

Explanation:

its literally a cell law .-.

3 0
3 years ago
Read 2 more answers
The placing of information or objects into groups based on certain similarities is_____
bearhunter [10]

Answer:

B.) classification

Explanation:

In biology, classification is a way to organize living things. In science generally, this could expand to include any type of object.

4 0
2 years ago
Fifty years ago, there were several hundred varieties of wheat grown in the Middle East. Now a few of the more modern high respo
UNO [17]

Answer:

They will have more environment to live.

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which linkages would you expect to find at a branch point in glycogen or amylopectin?
    15·1 answer
  • What is the pattern of inheritance for a rare recessive allele [a] every affected person has an affected parent. [b] unaffected
    8·1 answer
  • Which of these conditions results in the formation of a bubo?
    13·1 answer
  • What are the scientific explanations of the origin of DNA?
    7·1 answer
  • Fat around organs
    12·1 answer
  • Imagine carefully weighing a metal can, leaving it out in the rain for weeks and weeks until it was very rusted, and then carefu
    13·1 answer
  • What do you notice about the Moon’s orbit?
    5·1 answer
  • Directions: Sort these words in these two categories.
    6·2 answers
  • 17. Which of the following is an acid?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!