1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cupoosta [38]
3 years ago
7

What are functions of protein

Biology
2 answers:
katen-ka-za [31]3 years ago
7 0

For example, enzymes are proteins that speed up chemical reactions in the body and hormones, like insulin, are proteins that regulate the activity of cells or organs. Some proteins transport materials throughout your body, such as hemoglobin, which is the oxygen-transporting protein found in your red blood cells

harina [27]3 years ago
7 0

Cells in ur body contain protein the five main functions are

building tissue and muscles

hormone production

enzymes

immune function

energy

You might be interested in
2. If someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1
dem82 [27]

Answer:

No because theirs 1000 people and how they gonna find you if there's other people scattered around.☺

Explanation:

4 0
3 years ago
Read 2 more answers
An egg, a model of a cell, is placed in a concentrated sugar solution (hypertonic) for 24 hours.
defon

Answer:

gain mass and increase in size

3 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
When does the nuptial flight occur in honey bees​
vlabodo [156]

Answer:

<em>When a queen gets old or weak and slows her production of queen substance, she is generally replaced by a new queen. New queens are also produced in colonies about to swarm. Virgin queen bees take what is known as a "nuptial flight" sometime within the first week or two after emerging from the pupal chamber.</em>

7 0
3 years ago
Describe Sex Cell?
geniusboy [140]

Answer:

Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes are called ova or egg cells, and male gametes are called sperm. Gametes are haploid cells, and each cell carries only one copy of each chromosome. ... In contrast, each egg cell, or ovum, is relatively large and non-motile.

Explanation:

5 0
2 years ago
Other questions:
  • The natural role of restriction enzymes in bacteria is to make conjugation more efficient. allow transposons to move to another
    15·1 answer
  • The evolutionary concept of ______________ proposes that species that are better able to adapt to the environment are more likel
    8·1 answer
  • Which describes an example of ecological succession?
    5·2 answers
  • The chromosomes in the illustration are
    7·2 answers
  • Linda thomas was diagnosed as having a/an _______. This is a benign tumor of the pancreas that causes hypoglycemia by secreting
    11·1 answer
  • Question 23
    12·1 answer
  • Help please (the subject is science)
    14·2 answers
  • The gulf flounder is a fish that is found in the Gulf of Mexico. It
    5·1 answer
  • Is the process by which simple materials are chemically combined to form more complex materials
    7·1 answer
  • Help me with this please
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!