1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedbober [7]
2 years ago
10

Which of the following is the best definition of an unsaturated fatty acid?

Biology
1 answer:
Volgvan2 years ago
8 0
I think it is a or c a basic unit of a lipid that consists of single and double carbon to
You might be interested in
What does it mean when a compound’s chemical formula does not include any numbers? A. There are only single bonds in the molecul
yaroslaw [1]

Answer:

B

Explanation:

This number that is put in a compound is called a subscript. It is put in front of the symbol of the element being represented. An example is CO₂ which means there are one (1) carbon and two (2) oxygen atoms in the compound.

3 0
3 years ago
Students who study perform better in school. What is the hypothesis
liraira [26]
That students who study make better grades than those who do not.
4 0
3 years ago
The image below shows a convergent plate boundary.
JulsSmile [24]

Answer:

the answer is volcanoes

Explanation:

The oceanic crust collides with the continental crust to form a convergent boundary. At the convergent boundary, the denser oceanic crust sinks under the lighter continental crust. The rocks of the oceanic crust reach very high temperatures of about 12,000°C, which is enough to melt the rocks. These molten rocks travel upward through cracks and crevices in the continental crust. They then erupt on the surface as volcanoes. Therefore, the feature expected to form at point X as the result of converging plates would be volcanoes.

8 0
2 years ago
Which of the three stages of cellular respiration is the most ancient?
Doss [256]
It's Glycolysis

Hope this helps :)
4 0
3 years ago
How could you increase the air pressure inside a bag containing a group of air molecules?
denpristay [2]
Add more pressure to the bag

4 0
3 years ago
Other questions:
  • What. Sphere makes up 75 percent of gasses on earth
    15·2 answers
  • Consider the model of the food chain. Imagine there is a herbicide poison spill and all the grass is killed. How will this influ
    14·2 answers
  • Studies of embryos of various species have shown a series of genes that
    7·1 answer
  • Which is the best definition of a phylogenetic tree
    8·2 answers
  • The _______ is responsible for forming the outer, limiting barrier of a cell.
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • HELPPPPPP!!! ASAPPPPP!!!!
    13·1 answer
  • Tylenol is the Name for the drug acetaminophen
    10·1 answer
  • Why are flood plain soils particularly fertile
    15·1 answer
  • 36. What are the two smaller tubes that branch off of the trachea?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!