1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
7

Name a technique that helps to maintain a high level of courteousness when driving

Biology
2 answers:
Andrews [41]3 years ago
8 0
Maintaining a courteous attitude while driving can be difficult yet there is a technique to have it.One is having a positive attitude. Examples would be being tolerant to other road users, forgiveness as well as recognition that people would make mistake. A sense of humor and a helpful attitude towards driver.
anastassius [24]3 years ago
7 0

Being Courteous on the road is very important. Being patient and keeping your cool on the road are attitudes that contribute in maintaining friendly relations on the road.  

Some of the possible ways are, to minimize the sources that will contribute in giving tension. Leaving early to reach your destination, avoid the rush hour, always cooperate with the fellow drivers on the road, give way to others while driving and do not use the phone while driving so that all the attention and concentration is on the road to prevent any accidents or conflicts.


You might be interested in
Which change to the ramp would be the best way to increase its medical efficiency (ME), and why?
olchik [2.2K]

Answer:

make it lower

Explanation:

because then it would be easier to maneuver

3 0
3 years ago
Which of the following is a density-dependent factor that may limit population growth?
Damm [24]
Spread of disease is density dependent because it is more severe the greater the population density as the disease would spread more easily. If there is low population density it would spread slower.
4 0
3 years ago
Two pieces of foil being heated by a candle. Warm atoms are red, and cool atoms are blue. The top foil has a small number of war
NeTakaya

Answer:

A: Heat flows in all directions

D: The atoms near the candle absorb heat first

F: Heat flows from the warmer atoms to the cooler atoms

Explanation:

4 0
2 years ago
2 points<br> Individuals that are well adapted to their environment will survive and<br> produce
Novosadov [1.4K]

Answer:

Individuals that are well adapted to their environment will survive and reproduce

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

3 0
3 years ago
An allele whose trait is hidden or does not really count when a dominant allele is next to it is called
slega [8]

Answer:

recessive

Explanation:

a recessive allele is the gene donated by one parent which is present within the genotype, but is not expressed in the phenotype of the person's characteristics.

8 0
3 years ago
Other questions:
  • A species can develop genetic diversity.
    13·2 answers
  • What substance was responsible for a major ozone depletion in the 1900s?
    12·1 answer
  • PLEASE HELP 15 POINTS!!!
    9·2 answers
  • What glues together molecules in adhesion and cohesion?
    5·1 answer
  • The domain that contains unicellular organisms that live in extreme environments is
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The DNA in a cell's nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well
    12·1 answer
  • Myosin from a rabbit will bind to actin from an amoeba. What does this suggest about the evolution of the structures of actin an
    8·1 answer
  • How are mutations and meiosis similar?
    12·2 answers
  • In the name staphylococcus aureus, staphylococcus is the ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!