1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
15

which term describes a pure substance that is made up of only one type of atom?1)matter2)rock3)compound4)element

Biology
2 answers:
Ierofanga [76]3 years ago
7 0

Elements is the answer that you are looking for

Brilliant_brown [7]3 years ago
6 0
Answer is "elements"
You might be interested in
We used a microscope marked ×10 on the eyepiece and ×25 on the objective to observe an object that is 0.5 mm long. How long will
Brums [2.3K]

Answer: 2500 i think don't count me on it though sorry if it is wrong.

Explanation:

8 0
2 years ago
Oth seagulls and wild geese are large birds. they're also similar in that both kinds of birds can fly over great distances. on t
rusak2 [61]
The correct option is A, FEEDING HABIT AND MIGRATION. From the passage given above, it can be seen that seagulls are scavengers, they usually eat from garbage dumps while wild geese eat seeds and insects, thus they differ in feeding habit. In term of migration, seagulls does not follow seasonal pattern of annual migration while wild geese do. These are the contrasts between the two birds. 
6 0
3 years ago
Read 2 more answers
These statements describe three different reactions.
Arte-miy333 [17]

Answer: 2 - The nucleus of an atom is split apart

Explanation: Any reaction involving the nucleus of an atom is called a nuclear reaction. It is different from ordinary chemical reactions that involve electrons because it involves the release of large amount of energy. Nuclear reactions can be classified as nuclear fission and nuclear fusion.

A nuclear reaction in which a nucleus of an atom is split into two smaller atoms with a release of large amount of energy is called nuclear fission. A nuclear reaction that involves the combination of lighter nuclei of elements to form heavier atoms that are more stable with the release of a large quantity of energy is called nuclear fusion.

5 0
3 years ago
Which country imports the most metals? A.Africa B.Japan C.Australia D.Russia
omeli [17]
Hi! Your correct answer would be,

B) Japan

Hope I helped, tell me if I'm wrong!
5 0
3 years ago
Read 2 more answers
The image below shows plant cells.
ExtremeBDS [4]
C.All organisms have cells with different shapes and functions
4 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which adaptive management stage helps us understand what objectives are actually met?
    6·1 answer
  • What is the difference between a tectonic plate and a hot spot?
    11·1 answer
  • What is the MAIN cause of increased erosion, especially for soil?
    13·2 answers
  • 3 common organisms that are made up of Eukaryotic cells examples
    15·1 answer
  • One role of fats is to _____.
    9·2 answers
  • Which best describes the scientific process
    10·1 answer
  • What is the definition of Dopamine
    10·2 answers
  • Help pleaseeeeeeeeeeeee ​
    5·1 answer
  • Relaying signals from the neuron to other cells is a function of the __________. A. Axon B. Axon terminals C. Myelin sheath D. C
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!