1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
2 years ago
5

HELPPP THIS IS MY LAST ONE AND ILL GIVE YOU BRAINLIEST MWAHH

Mathematics
1 answer:
kirill [66]2 years ago
6 0

Answer:

B. 36

Step-by-step explanation:

6 + 30

You might be interested in
you can buy a 1.5 lbs bag of gummy bear for $4.35 or spend $5.30 for 2 lbs of gummy bears. Which of the bags is a better deal?
alukav5142 [94]

Answer:

The 2 pound bag of gummy bears

Step-by-step explanation:

You do 1.5/4.35 which = 2.9 the 2.9 is $2.90 per pound

Then, you do 5.3/2 which = 2.6 this 2.6 is $2.60 per pound

$2.60 <  $2.90 there for the 2 pound bag of gummy bears is the better deal

3 0
3 years ago
If lena is making 10.5B dollars a year how many years will it take lena to make 100B dollars?
PIT_PIT [208]
100/10.5= 10
hope this helps

4 0
3 years ago
Read 2 more answers
If you buy a radio that cost $860 and sales tax is 6%. Find the total price you would pay.
pashok25 [27]

Answer: $911.60

Step-by-step explanation: 860 time 6% is 911.60

8 0
3 years ago
4x-y=1 inslope intercept form please show work
shutvik [7]

Answer:

y = 4x - 1

Step-by-step explanation:

the equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y-intercept )

rearrange 4x - y = 1 into this form

add y to both sides

4x = y + 1 ( subtract 1 from both sides )

4x - 1 = y

y = 4x - 1 ← in slope-intercept form


5 0
4 years ago
30 points for whoever gets it right! !!
kramer
3)
GCF of 18 and 22 is 2
GCF of 25 and 50 is 25
GCF of 54 and 36 is 18
GCF of 40 and 8 is 8
GCF of 16 and 24 is 8
4) 
GCF of 10 and 15 is 5
GCF of 24 and 30 is 6
GCF of 8 and 10 is 2
GCF of 5 and 24 is 1
GCF of 24 and 40 is 8
5)
GCF of 8 and 12 is 4
GCF of 15 and 4 is 1
GCF of 20 and 4 is 4
GCF of 3 and 24 is 3
GCF of 12 and 4 is 4
6) 
GCF of 15 and 2 is 1
GCF of 12 and 30 is 6
GCF of 4 and 30 is 2
GCF of 6 and 40 is 2
GCF of 10 and 2 is 2
6 0
3 years ago
Other questions:
  • Graph.<br><br> F(x) = |2x-6| + 3
    14·1 answer
  • Help, please. I will give brainliest to anyone that answers first. ​
    12·2 answers
  • How do I solve 1.06g-7=0.95
    7·1 answer
  • Eighth grade &gt;<br>V.13 Multiply using the distribu<br>Simplify the expression:<br>3(3 + 4y)​
    8·1 answer
  • Which method of finding the distance is the best? explain.
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help with math question
    5·1 answer
  • Solve for V in V= s^3, if s= 4.<br><br> V=
    15·2 answers
  • The function () is shown in this graph.
    11·1 answer
  • How many hours is 7:45 to 1:00
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!