1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
3 years ago
13

Two positively charged objects (Object A and Object B) are 8 inches apart. When a positively charged ball is hung at an equal di

stance between the two positively charged objects, the ball moves toward object B (see figure).
What can you conclude about the relative amount of positive charge on Object A and Object B? Provide support for your claim.

Your answer:

Biology
1 answer:
dimaraw [331]3 years ago
3 0

Answer:

Object B has more charge than Object A

Explanation:

Generally, unlike charges attract each other and like charges repel each other but it happens in a very rare case when like charges attract each other. It is so due to charge difference between the objects.

In the given example a positively charged ball moves towards positively charged object B because object B has more charge than object A and the ball. Due to large difference in the charges between two positive charges, positive charges are displaced at opposite end and object B get concentrated with negative charges that allows ball to move towards Object B.

Hence, the correct answer is "Object B has more charge than Object A".

You might be interested in
What is substance in science?
Anton [14]

Answer: A substance is matter which has a specific composition and specific properties. Every pure element is a substance. Every pure compound is a substance. Examples of substances: Iron is an element and hence is also a substance.

Explanation:

3 0
3 years ago
Read 2 more answers
In the desert, saguaro cacti, owls, horned lizards, and fire ants all share the same space.
Ann [662]

Answer:

all species in same area

7 0
2 years ago
Read 2 more answers
When we combine DNA and protein to create our chromosomes we referred to that combination as?
Sergio [31]
The answer to your question is B.Chromatin
6 0
2 years ago
Read 2 more answers
Which is a key element found in all carbohydrates,lipids, proteins, and nucleic acids?
nekit [7.7K]
Im pretty sure it B Carbon
8 0
3 years ago
In which of the following situations would exocytosis be the proper mechanism of membrane transport?
cluponka [151]

Answer:

Secretion of the neurotransmitter serotonin, which is a water-soluble amine molecule

Explanation:

Exocytosis is defined as the process where cell transports secretary products which are packaged in transport vesicles such as antibodies, peptide hormones, secretory proteins, and enzymes with the help of cytoplasm to the plasma membrane.

Some example of exocytosis are:

1) Neurotransmitters secrets from nerve cells.

2) Antigens which helps to stimulate the immune response.

3) Proteins of the plasma membrane.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Can malaria be transmitted through blood transfusion
    11·1 answer
  • Besides the ability of some cancer cells to over proliferate, which of the following situations might logically result in a tumo
    12·1 answer
  • What is the effect of having less compact bone than normal on the strength of the skeletal system?
    8·1 answer
  • Halons and CFC's both
    14·2 answers
  • Which two conditions do most seeds need in order to germinate?
    9·1 answer
  • Part C What is the name of the chemical that is branched?
    7·1 answer
  • Who discovered penicillin and how ?
    9·1 answer
  • Organisms that are able to make organic molecules from inorganic sources, such as carbon dioxide and water, are called.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!