1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
13

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for pho

tosynthesis?
Biology
2 answers:
Ahat [919]3 years ago
5 0

Answer:

Carbon dioxide, water and sunlight

blondinia [14]3 years ago
5 0

Answer:

water and sunlight

Explanation:

You might be interested in
13)
nekit [7.7K]
B) in a swimming pool
8 0
3 years ago
Your respiratory muscles contract each time you exhale.<br><br><br> TrueFalse
Virty [35]
False,your respiratory muscle expand each time when you exhale.
6 0
3 years ago
David wants to improve the food shortage situation in his country. Which of these fields of biology should he study?
Lostsunrise [7]

Answer:

B

Explanation:

food source deals with agriculture aka farming

4 0
3 years ago
This type of energy splits nuclei or combines them
hjlf

Answer:

B. Nuclear energy

this type of energy splits nuclei or combines them.

4 0
3 years ago
Read 2 more answers
A shipping company employee notices that the inside of ships' hulls where ballast water is stored are deteriorating. The hull pa
puteri [66]

Answer:

The bacteria were growing through fermentation process.

Explanation:

Cyanide have the ability to prevent the growth of microbes, and that is why it usually added to paints that want to be applied to places where the growth of microbes will be harmful to people.

The ships' hull where ballast water is been stored needed to be painted with cyanide to prevent the growth of microbes.

It should be noted that,  anaerobic microbes have the ability to reduce cyanide compound through a process known as submerged fermentation.

In the case of ships' hull, the bacteria growing on the hull were anaerobic, which means, they carried out their activities in the absence of oxygen.

7 0
3 years ago
Other questions:
  • Which of the folloeing best describes mama the narrator of the story?
    10·1 answer
  • 2. Mercury (II) oxide decomposes into mercury and oxygen gas according to the following
    12·1 answer
  • The region of the abdominopelvic cavity that is inferior and medial to the left lumbar region is the:
    13·1 answer
  • Juan rides his horse at a speed of 12 miles per hour. How long does it take Juan to travel 60 miles on his horse at this speed?
    10·2 answers
  • Humans can digest starch but not cellulose because _____. the monomer of starch is glucose, while the monomer of cellulose is ga
    9·1 answer
  • El agua es ácido,base o neutro?
    5·1 answer
  • What are the 3 organelles that are present in plant cells but not in animal cells?
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • After a zygote undergoes cleavage division it is called a ____
    10·2 answers
  • Label electron micrograph of B lymphocyte.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!