1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
3 years ago
8

If someone sitting at the other end of a restaurant smokes a cigarette, you may still breathe some in some of the smoke. The mov

ement of smoke through the air of the restaurant is an example of what type of transport?
a. osmosis
b. diffusion
c. facilitated diffusion
d. active transport​
Biology
1 answer:
34kurt3 years ago
8 0

Answer:

C.facilitated diffusion

Explanation:

Because it have some chemicals did you breathe from the person who using cigarettes.

You might be interested in
Would you expect the other pairs of students in your class to have an offspring similar to yours
nikdorinn [45]
No, because everyone has different DNA and genetics.
3 0
3 years ago
Adhesives used to bond the plies together classifies plywood as either
PIT_PIT [208]

Answer:

what is the question I will help you I'm comments

3 0
3 years ago
You have the following consumable items that you do not want spoiled by the action of microorganisms, but you have space in your
Llana [10]

Answer:

Bread Flavored syrup (contains water, high sugar concentration, flavors, e.g., used to flavor coffee and drinks)

Explanation:

Food spoilage refers to a situation in which food is no longer fit for consumption due to the action of certain microorganisms on the food. Hence, microorganisms cause the spoilage of food and beverages.

The rate of action of microorganisms on different beverages depends mostly on the content of the beverages.

Yeasts are often responsible for the spoilage of beverages with high sugar content and these tend to spoil faster than other beverages.

6 0
2 years ago
What is function of capillaries
VladimirAG [237]
Capillaries are the end structures in the artery system that bring oxygenated blood from your lungs to the rest of your body.
7 0
3 years ago
How do we get Proteins
Leona [35]

Answer:

By eating things with protein in it. Sorry if this sounds too simple, but that's all it is.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is an appropriate hypothesis to answer the question why are leaves green
    6·1 answer
  • a chloroplast is releasing large amounts of oxygen. what does this tell you about other processes are going on inside the chloro
    10·1 answer
  • Q 15.19: Cell bodies of preganglionic neurons of the parasympathetic division are located in which of the following cranial nerv
    10·1 answer
  • transition metals are A. good conductors of thermal energy B. more reactive than alkali metals C. not good conductors of electri
    6·1 answer
  • Need help. ASAP What are considered characteristics of science? Select all that apply. - Scientific experiments are not falsifia
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the three R's of conservation ??
    15·2 answers
  • Ina concludes that color does influence the attraction of butterflies and moths do you think this is a logical conclusion
    7·2 answers
  • Phytopharmaceuticals are pharmaceutical compounds that are found in plants. They can be naturally occurring or a result of biote
    8·2 answers
  • 14. The neuromuscular junction is
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!