1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
6

Which term refers to the fact that naturally occurs omg he universe

Biology
1 answer:
ElenaW [278]3 years ago
7 0

Answer:

Scientific law.

Explanation:

A scientific law is a statement that the scientific community elaborates on after observing a natural phenomenon and performing several experiments concerning certain phenomena. Scientific laws aim to explain the reasons why something happens and what may cause it to predict it in the future.

You might be interested in
Which plant structure is the dominant sporophyte of angiosperms?
Elenna [48]
Flowers are the <span>plant structure that is the dominant sporophyte of angiosperms.</span>
5 0
3 years ago
Read 2 more answers
What are the four unifying principles that form the foundation of modern biology?
Vikentia [17]
Four unifying principles form the foundation of modern biology<span>: cell theory, evolutionary theory, the gene theory and the </span>principle<span> of homeostasis. These </span>four principles<span> are the founding principles of each category of biology</span>
5 0
3 years ago
What type of cell makes bone tissues
zvonat [6]

Answer:

A balance between Osteoblasts and osteoclasts maintain bone tissue.

Explanation:

Osteoblasts are bone making cells, osteoclasts resorb or break down bone, and osteocytes are mature bone cells.

7 0
3 years ago
Nick made the chart below to show the future impact of four energy production
Mumz [18]
I am pretty sure the answer is c
3 0
3 years ago
Both sound and water waves require a<br> to travel. This means they are
Mekhanik [1.2K]

Answer:

mechanical waves

Explanation:

They require a medium to travel through.

7 0
3 years ago
Read 2 more answers
Other questions:
  • The building block that makes up a nucleic acid is a(n) _______. <br><br> Someone help please ??
    8·1 answer
  • If you sustain an injury to the shoulder joint (infraspinatus muscle) how would it affect the movement of the shoulder?
    8·1 answer
  • Air pollution is killing more children than what two diseases?
    5·1 answer
  • 19.2 Choose the correct answer.
    13·2 answers
  • The food source that is produced during photosynthesis is
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the main cause of the damage to trees on Grandfather Mountain?
    12·2 answers
  • What will happen to OTHER ORGANS if kidneys malfunction due to certain disease
    11·1 answer
  • Individual atoms do not have color. Why are models often made with several specific colors?​
    10·1 answer
  • Please Help I Don't Understand!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!