Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
No they can not
Glad I could help
Answer:
D. 1 BB : 2 Bb : 1 bb
Explanation:
This question involves a single gene coding for fur color in guinea pig. Black fur (B) is dominant over white fur (b). This means that, as stated in the question, if a black fur parent (BB) is crossed with a white fur parent (bb), a 100% heterozygous offspring (Bb) with black fur will result.
If two heterozygous guinea pigs are crossed i.e. Bb × Bb, the following gametes will be produced by each heterozygous parent:
Bb = B and b
Using these gametes in a punnet square (see attached image), offsprings with the following genotypic ratio will be produced:
1 BB : 2 Bb : 1 bb
BB and Bb = black fur guinea pigs
bb = white fur guinea pigs
A. light energy, above the arrow
<span>Photosynthesis is a process wherein light energy is converted into chemical energy. </span>
Components of photosynthesis:
Water
Carbon Dioxide
Light energy, mostly from sunlight, is the main requirement for photosynthesis to occur.
