1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
12

Which of the following explains why the Multiple-Use Sustained-Yield Act was necessary?

Biology
1 answer:
ehidna [41]3 years ago
8 0
Forest being opened to industries led to too great a depletion on many resources
You might be interested in
Earth's ______ causes the Coriolis effect.<br> •winds<br> •rotation<br> •temperatures
Sholpan [36]

  • B) Rotation

\:  \:  \:

Earth's rotation causes the Coriolis effect.

\:  \:  \:

\:  \:  \:

\:  \:  \:

\:  \:

Hope Helps `~~

6 0
3 years ago
Read 2 more answers
PLEASE HELP FAST !!!!!!!!!!!!!!!!!!!Which of these is the most likely use of an electromagnetic wave which has frequency lesser
alukav5142 [94]
Could be the answer c 
6 0
4 years ago
Read 2 more answers
Define water purification?​
leonid [27]
Water purification is the process of removing undesirable chemicals, biological contaminants, suspended solids, and gases from water. The goal is to produce water fit for specific purposes.
4 0
3 years ago
Chlorine gas (Cl2) forms when two chlorine atoms share an electron. What type of bonding is present in chlorine gas? A. ionic B.
Flura [38]
B) Covalent, the answer you have been looking for.
4 0
4 years ago
which of the following steps is an important part of the process by which ecology guides humans to a sustainable future
Leto [7]
Behaivor is modified as a cause
6 0
4 years ago
Other questions:
  • You are driving in the left lane on a four-lane freeway and have to take the exit on the right. you should ______________.
    13·1 answer
  • Which of the following is true about bases?
    9·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following best describe matter
    9·2 answers
  • Which of the following can be used to communicate ideas? A. symbols and illustrations B. charts and spreadsheets C. oral and wri
    5·2 answers
  • In plants, which of the following are produced by meiosis?
    10·1 answer
  • The presence of gill-kill slits in a human embryo is considered to be evidence of the
    5·1 answer
  • Composed of mostly proteins and lipids, the cell membrane serves as the attachment point for the intracellular cytoskeleton in a
    5·1 answer
  • Explain the structure of three types of muscle fibres.Also write the location where they are found in the body.
    12·1 answer
  • Assignment Summary For this assignment, you will model the structures of the cell and describe their functions. You will do this
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!