1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
9

For my science fair project, Im doing "Which plant fertilizer works best?"

Biology
1 answer:
mart [117]3 years ago
7 0
You could do regular daisies, or pet grass... It could be almost anything.
I hope this helps!<span />
You might be interested in
Kfj-dqme-ybq joun me with this code dear girls fast​
Westkost [7]
Answer: still no lol
5 0
3 years ago
In rabbits, short hair (S) is dominant over long hair (s). What genotype and phenotype ratios are
Kazeer [188]

Answer:

Genotype                  Phenotype                      

SS                 1/4          Short hair         3/4

Ss                 2/4         Short hair          3/4

ss                  1/4          Long hair          1/4

Explanation:

The resulting off-spring would have the following genotype and phenotype:

1 out of 4 will have a genotype of SS.

2 out of 4 or half will have a genotype of Ss.

1 out of 4 will have a genotype of ss.

But because short hair is dominant the phenotype ratios would differ because Ss and SS would express short hair, so we add up their ration:

Short hair: 1/4 + 2/4 = 3/4

Long hair:  1/4

3 0
3 years ago
How do tulips reproduce?asexually or sexually?
Masja [62]

Answer:

dont care

Explanation:look on other webs

3 0
3 years ago
Read 2 more answers
Darwin explained that all life came from ________________
AnnZ [28]

Answer:

one common ancestor

Explanation:

Although Darwin’s theory is often described as the theory of evolution by natural selection, most commentators recognize that common ancestry (the idea that all organisms now alive on earth and all present day fossils trace back to one or a few “original progenitors”) is an important part of the Darwinian picture.

3 0
3 years ago
Which process must occur before mitosis and meiosis can occur?​
STALIN [3.7K]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ Before mitosis and meiosis occur, DNA replication has to occur. DNA replication is when another copy is made of the DNA and in mitosis and meiosis, you need the replicated DNA for the sister chromatids.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

4 0
3 years ago
Other questions:
  • An organism of the genus Staphylococcus is ________, while an organism of the genus Spirochaeta is ________.
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A student collected the above data for this experiment. What error did he make? Explain. Mass of the Graduated Cylinder
    7·2 answers
  • Identify cell structures used for direct contact in animal cells
    9·1 answer
  • Explain how bacteria become resistant to antibiotics
    12·1 answer
  • Cladogram worksheet key
    9·1 answer
  • An area has experienced weathering and erosion for many years. Over time, some rock formations have been left behind forming pea
    5·1 answer
  • The periosteum is secured to the underlying bone by ________.
    14·1 answer
  • 5. Interpret the experiment design and select what Elizabeth is likely to observe.
    13·1 answer
  • Is this correct? Please help asap tysm
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!