5. When cells are dividing, it is important to understand that they have to move chromosomes

Biology

1 answer:

natta225 [31]2 years ago

3 0

Answer:

Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA). Passed from parents to offspring, DNA contains the specific instructions that make each type of living creature unique.

i hope it helps

You might be interested in

The Chinese-Japanese War (aka the Sino-Japanese War) primarily had to do with __________. Japan China Korea Russia

ankoles [38]

Between Japan and China in Korea. Fought over the control of Korea basically.

7 0

2 years ago

Which consumer are maggots in the food chain

tangare [24]

Maggots are decomposers

3 0

2 years ago

When Mendel crossed true–breeding pea plants that have inflated pods (PP) with those that have constricted pods (pp), it was obs

Elena-2011 [213]

It is the first choice, since that (P) is dominant to (p) so yeah Pp will be inflated

6 0

2 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

How do you clam and earthworm organs differ

-Dominant- [34]

Answer:

The marine clamworm, Nereis, is carnivorous therefore its digestive system differs from that of the herbivorous earthworm, Lumbricus. The mouth and jaws are retractable (Figure 8, 9). If the jaws are retracted, cut along the midline of the pharynx and pull the jaws out with a pair of forceps.

Explanation:

hope it helps:>

5 0

2 years ago