1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesantik [10]
3 years ago
8

Choose the stage that best matches the description given.

Biology
1 answer:
Umnica [9.8K]3 years ago
3 0

Answer:

1-3 Days

Explanation:

You might be interested in
Carbon dioxide is a compound that is made up of __bonds and, therefore, has melting and boiling points that are generally __. A)
tino4ka555 [31]
The answer is A. covalent, high.
7 0
3 years ago
What killed the great beasts of North America
Ilia_Sergeevich [38]

Answer:

incoming Paleoindians, the first Americans, who allegedly hunted them to extinction.

5 0
3 years ago
A population of beetles changing from yellow to green and surviving better is an example of
Nata [24]

Answer:

C. natural selection

Explanation:

Natural selection is when the organisms that have the better adaptation so they survive. In this case, the green was the better adaptation so they lived.

6 0
3 years ago
Why did the Spanish bring enslaved people from West Africa to New Spain
IceJOKER [234]

Answer:

i don't know

Explanation:

I'm just trying to get points

3 0
3 years ago
A fish tank is a type of human-made ecosystem. Which of the following lists only abiotic factors found in a fish tank ecosystem?
aalyn [17]

D. Water, Oxygen, Constant temperature

5 0
3 years ago
Read 2 more answers
Other questions:
  • What happens when an essential amino acid is missing from the diet
    7·2 answers
  • What are the factors that allow the aquatic pyramid of biomass to be inverted?
    6·2 answers
  • During a pulse-chase experiment, photographic emulsions were prepared at different times during the chase, and radioactive spots
    5·1 answer
  • What is sustainability?
    13·2 answers
  • Seawater is more dense than fresh water. A ship moving from the Atlantic into the Great Lakes goes from seawater to fresh water.
    8·2 answers
  • Three examples of complex hereditary diseases are cardiovascular disease, type 2 diabetes, and .
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Cells contain special ____
    9·1 answer
  • 15,000 years ago, when humans were foragers and hunters, what characterized daily life? What were humans eating, and where and h
    6·2 answers
  • What is an example of chemical weathering, as opposed to mechanical weathering?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!