1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
3 years ago
12

The root word “lun” or lune refers to the ____________

Biology
1 answer:
ANEK [815]3 years ago
8 0

Answer:

Lun or Lunar are references for the moon.

You might be interested in
Which procedure involves the surgical removal of an entire breast and many of the surrounding tissue?
Ilya [14]
Mastectomy is the surgical procedure that involves removal of an entire breast and many of the surrounding tissue
5 0
3 years ago
What is a beneficial association between the roots of a plant and a fungus?
Gnom [1K]

Answer: Mycorrhiza

Explanation: Mycorrhiza is a symbiotic relationship between a plant and a fungi. Nearly 80 percent of all plants with root systems participate in this mutualistic relationship. In mycorrhiza, the fungus forms a haustoria that penetrates the cell walls of the plant's roots. The fungus absorbs all the nutrients from the roots as they are transported to the plant. In return, the fungus gives the plant necessary chemicals and minerals that it cannot properly reach on its own.

3 0
3 years ago
Read 2 more answers
When was the first time a scientist has used fruit flies to study DNA?
Nitella [24]

Answer:

I think it was Thomas Hunt Morgan

8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Plz help! I will mark Brianliest!
olga nikolaevna [1]
They’ve helped end/calm down pandemics and epidemics and allowed us to go out and start living our life again.

You don’t have to use this word for word just an idea
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is an experimental curve?
    11·1 answer
  • How does the respiratory system interact with the circulatory system?
    15·1 answer
  • The average time to death from starvation in a fruit fly is about 20 hours. selecting for increased starvation resistance in fru
    15·1 answer
  • The term ____ is used for genes that have nothing to do with gender yet are carried on the x chromosome
    14·1 answer
  • Role of mulluscus in soil
    15·1 answer
  • True or false, heart muscle can depolarize spontaneously in the absence of any external stimulation
    9·2 answers
  • Some proteins require certain temperatures?<br><br> True<br><br> False
    14·1 answer
  • The Sahel region of Africa, just south of the Sahara, consists mostly of which biome?
    11·1 answer
  • soil is created through the weathering of rocks. which of the following aids directly in the weathering and transportation?
    9·1 answer
  • 12.What is an invasive species?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!