The differences between the geomagnetism and electromagnetism are given below.
<h3><u>Explanation</u>:</h3>
Geomagnetism is defined as the magnetic field that is located all around the earth. Whereas electromagnetism is defined as the magnetic field that is produced due to passing of electricity through a conductor.
The geomagnetism is formed because of the molten elements of iron etc which are present inside Earth's core, and are continuously moving. It mostly resembles the solid block magnet in its field characteristics. But electromagnetism is different. It can be changed according to the current input which isn't possible for Earth’s magnetic field.
Answer:
b. pass through pores in the capillary endothelium
Explanation:
The fenestrated capillaries and sinusoids have pores in their endothelium. These pores or the intracellular clefts vary in size between the fenestrated capillaries and sinusoids. Sinusoids have larger intracellular clefts. The pores serve as a passage for the movement of water-soluble substances, proteins and other substances that cannot cross the hydrophobic interior of the cell membranes.
Water-soluble hormones also cannot pass through the capillary walls. Therefore, these hormones pass through the pore or the fenestrations present in the endothelium of capillaries.
Answer:
how can I help u with.
I can't see any pictures
u post a question picture.
I can answer u
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
