1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lorico [155]
3 years ago
6

What is the first step in photosynthesis?

Biology
2 answers:
Sladkaya [172]3 years ago
6 0

Answer:

The first step of photosynthesis is when a plant takes in water, sunlight, and carbon dioxide.

The products of photosynthesis are Oxygen and Glucose (Sugar)

The process of photosynthesis is the process that plants use to make energy. They take in Water and Carbon Dioxide, and use sunlight to turn it into energy and oxygen. The energy is glucose which is a type of sugar.

Gennadij [26K]3 years ago
4 0

Answer:

Photosynthesis occurs in two stages. In the first stage, light-dependent reactions or light reactions capture the energy of light and use it to make the energy-storage molecules ATP and NADPH. During the second stage, the light-independent reactions use these products to capture and reduce carbon dioxide.

Explanation:

You might be interested in
The height of wind formed waves depends on what three things?
Ganezh [65]
The height wind waves or waves generated by the wind are surface waves that occur on the surface of oceans, lakes, rivers, seas and canals etc. Waves can travel thousands of miles before reaching land. They range in size from small ripples to over 100 foot high. They are dependent on the following three things:
1. Wind speed - the height of waves is dependent on the speed of the wind. The faster the wind, the higher the waves and vice versa. 2. Wind direction - the height of waves is dependent on  whether the wind is blowing offshore or onshore. Offshore winds blow from the land onto the sea so tend to cause bigger waves3. Storm winds in a cyclone or hurricane. These winds travel in circles around the eye of the storm and are usually very high in intensity. Depending on the intensity of the wind and the speed at which the wind is travelling, the wave height will differ. 



7 0
3 years ago
What is a caplire use for
saveliy_v [14]

Answer:

A device to measure the dimensions of a object

Explanation:

6 0
3 years ago
Chemical transmitters can stimulate any receptor site to initiate an action.
dimaraw [331]
Not true, certain chemical transmitters stimulate certain receptors
4 0
3 years ago
What type of wave do the contractions of a snakes muscle make as a snake moves forward
Oliga [24]
It makes a longitudinal wave because it stretches and compresses while it slithers forward
7 0
3 years ago
What organic molecules are important to your life?
Arte-miy333 [17]

Answer:All organisms need four types of organic molecules: nucleic acids, proteins, carbohydrates and lipids; life cannot exist if any of these molecules are missing.

Nucleic Acids. The nucleic acids are DNA and RNA, or deoxyribonucleic acid and ribonucleic acid, respectively. ...

Proteins. ...

Carbohydrates. ...

Lipids.

Explanation:

5 0
3 years ago
Other questions:
  • What is the primary role of the respiratory system in living organisms
    7·2 answers
  • The _____ implies that each individual is genetically programmed to carry a particular amount of body weight.
    7·1 answer
  • Which of the following reasons explains why electrical cords are plastic coatings with metal wires on the inside? A.Both plastic
    12·2 answers
  • How many chromosomes will be left after meiosis
    10·1 answer
  • Which structure can secrete a substance into the environment surrounding the body?
    12·2 answers
  • Why do all microorganisms produce pyruvate via glycolysis?
    9·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Reducing, reusing, and recycling are used to Group of answer choices make more ores increase metal production burn fossil fuels
    14·1 answer
  • What happens after step (iv) in the diagram shown below?
    11·1 answer
  • Which two types of rna pair up using a codon-anticodon link?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!