During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer: <em>Blue light is scattered in all directions by the tiny molecules of air in Earth's atmosphere. Blue is scattered more than other colors because it travels as shorter, smaller waves. This is why we see a blue sky most of the time. Closer to the horizon, the sky fades to a lighter blue or white.
</em>
Explanation: Hope it help have a great day
:)
Answer:
Reticular activating system (RAS)
Explanation:
Answer:
The hypothalamus plays ahuge role in the endocrine system. It is responsible for maintaining your body's internal balance of temperature.
When your hypothalamus senses that you're too hot, it sends signals to your sweat glands to make you sweat and cool your temperature.
When the hypothalamus senses that you're too cold, it sends signals to your muscles that make your shiver and create warmth, rising your temperature.
They re called granum singular and grana plural
