1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
13

What are two ways deer depend on plants to survive

Biology
1 answer:
Veseljchak [2.6K]3 years ago
8 0
One is for nutrients they get from eating it, and another is to create oxygen they need to survive. A third reason could be that deers can also use plants as shelter
You might be interested in
Sally sustained damage to some autonomic ganglia. What part of the visceral reflex arc is interrupted
AnnZ [28]

The part of the visceral reflex arc that is interrupted is the motor response in a target cell.  The visceral reflex is part of the autonomic nervous system (ANS).

The visceral reflex arc refers to the reflex arc present in the autonomic nervous system (ANS).

This reflex arc (visceral reflex) generates glandular muscular (motor) responses within internal organs.

The visceral nervous system controls different body functions including, among others, digestion, respiratory rate, heart, pupillary dilation, etc.

Learn more about the visceral reflex arc here:

brainly.com/question/25698063

7 0
2 years ago
In multicellular organisms which of the following is the highest level of cellular organization? A.)Cells B.)Organs C.)Tissues D
kykrilka [37]
Cells create tissues which create organs which make up systems so i believe the answer is D i hope this helps :)

3 0
3 years ago
Read 2 more answers
(blank) occurs due to a genetic mutation in the hemoglobin gene resulting in poor oxygen supply. the patient requires frequent b
Elan Coil [88]

Beta thalassemia is a blood disorder that reduces the production of hemoglobin

7 0
3 years ago
What bones are in your body?
bonufazy [111]
Bones for ur feet and bones for ur head is in ur body
7 0
3 years ago
Is Zinc is a silver-gray metal qualitative, quantitative, or neither
grigory [225]
The answer is qualitative

5 0
3 years ago
Other questions:
  • What type of mixture is maple syrup
    11·1 answer
  • Some muscle cells have the ability to produce more mitochondria if they are involved in regular exercise. Which answer correctly
    6·1 answer
  • Structure A is a _____.
    11·1 answer
  • What does an epidermis look like
    11·1 answer
  • Plants produce more oxygen through photosynthesis during the day than they use for cellular respiration
    7·2 answers
  • Which of the following cells is formed by meiosis?
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Explain two ways in which the existence of green algae and land plants affected the early atmosphere.
    5·2 answers
  • How can insulin deficiency lead to an increase in blood glucose concentration?
    6·1 answer
  • The observation that members of a population are uniformly distributed suggests that A. resources are distributed unevenly. B. t
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!