1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

2. During photosynthesis, carbon dioxide and (oxygen / sodium chloride / water I

Biology
1 answer:
Westkost [7]3 years ago
7 0

Answer:

water for first

sugar for second

oxygen for third

You might be interested in
Which increases the rate of soil formation?
Ludmilka [50]
In my opinion mixed layers would be the best choice
5 0
3 years ago
Read 2 more answers
Question 3 (1 point)
Mumz [18]

Answer:

False

Explanation:

Mass of Particle: Heavier particles will move more slowly and so will have a slower rate of diffusion. Smaller particles on the other hand will diffuse faster because they can move faster.

4 0
3 years ago
Requires environmental influences for the gene to be expressed in the
geniusboy [140]

Answer:

polygenic

Explanation:

3 0
3 years ago
People are likely to detect male prejudice against females ________ easily than they detect female prejudice against males. they
kifflom [539]

Answer:

more; less

Explanation:

8 0
3 years ago
1. cells are the basic units of________and_______in all living things.
Ludmilka [50]

Answer:

1. Life, exist 2. pre-existing cells.

Explanation:

3 0
3 years ago
Other questions:
  • How is taxonomy used to determine how closely two organisms are related?
    7·1 answer
  • Describe where an allele is located on a chromosome
    15·1 answer
  • What kind of molecule is represented in the diagram?
    6·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How are the structures of arteries, capillaries, and veins similar? How are they different?
    11·1 answer
  • What happens during carbon fixation?
    6·1 answer
  • What is a health claim? What is a structure-function claim? What kind of claim is made on the Enviga® label, if any? List  othe
    8·1 answer
  • HELLLLPPPPPPPP Which statements describe asexual reproduction? Check all that apply
    15·2 answers
  • What adaptations of large herbivores allow them to live in the taiga? (Select all that apply.)
    8·1 answer
  • In the cells of most organisms, DNA is contained in the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!