1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
3 years ago
8

What was the function of the Tigris River in Mesopotamian irrigation?

Biology
1 answer:
Anarel [89]3 years ago
4 0

Answer:

It supplied silt to the nearby farmland

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
7. All the virus has circular nucleic acid. True or False?​
ELEN [110]

Answer:

The genome is usually organized as a single linear or circular molecule of nucleic acid

Explanation:

6 0
3 years ago
What is the fluid in the blood that contains water, nutrients, protines, salts and hormones?
topjm [15]
I believe it is nutrients

3 0
3 years ago
HELP ME PLS!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Taya2010 [7]

Answer:

The first answer choice

Explanation:

4 0
3 years ago
Read 2 more answers
Why a plant which is left in the dark for a long period of time will test negative for starch?
Zanzabum
When a plant is left in dark for several hours, it does not get sunlight. Isn't it?
When a plant does not get sunlight, it cannot prepare food for itself , i.e, photosynthesis does not take place. When it does not prepare food in the form of starch, it will test negative for it.

hope it helps!
3 0
3 years ago
Other questions:
  • Why is genetic drift most common in small populations
    10·1 answer
  • In cumulene, what are the c=c=c and h−c−h bond angles, respectively? enter the c=c=c bond angle followed by the h−c−h bond angle
    15·1 answer
  • Soo-Jung used the subtraction property of equality to solve an equation for y. Which equation could be the one that Soo-Jung sol
    14·2 answers
  • How are plants pull toward the sun
    14·1 answer
  • How would i do this?
    7·1 answer
  • Which safe practice is part of using aseptic technique?
    14·1 answer
  • What happens to the body cells if the kidney produce very little urine?
    13·2 answers
  • 4. Describe your results.<br> I
    5·2 answers
  • What is the difference between Pulmonary and Cellular Respiration?
    11·1 answer
  • Salivary glands release a liquid called saliva, which helps to break food down.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!