All categories

3 years ago

Influenza is a highly contagious viral infection that affects our nose,

Biology

2 answers:

atroni [7]3 years ago

6 0

Answer:

Song by BTS

Overview

Lyrics

Videos

Listen

'Cause I-I-I'm in the stars tonight

So watch me bring the fire and set the night alight

Shoes on, get up in the morn'

Cup of milk, let's rock and roll

King Kong, kick the drum, rolling on like a Rolling Stone

Sing song when I'm walking home

Jump up to the top, LeBron

Ding dong, call me on my phone

Ice tea and a game of ping pong

This is getting heavy

Can you hear the bass boom? I'm ready (woo hoo)

Life is sweet as honey

Yeah, this beat cha-ching like money, huh

Disco overload, I'm into that, I'm good to go

I'm diamond, you know I glow up

Hey, so let's go

'Cause I-I-I'm in the stars tonight

So watch me bring the fire and set the night alight (hey)

Shining through the city with a little funk and soul

So I'ma light it up like dynamite, whoa oh oh

Bring a friend, join the crowd

Whoever wanna come along

Word up, talk the talk

Just move like we off the wall

Day or night the sky's alight

So we dance to the break of dawn

Ladies and gentlemen, I got the medicine

So you should keep ya eyes on the ball, huh

This is getting heavy

Can you hear the bass boom? I'm ready (woo hoo)

Life is sweet as honey

Yeah, this beat cha-ching like money

Disco overload, I'm into that, I'm good to go

I'm diamond, you know I glow up

Let's go

'Cause I-I-I'm in the stars tonight

So watch me bring the fire and set the night alight (hey)

Shining through the city with a little funk and soul

So I'ma light it up like dynamite, whoa oh oh

Dy-na-na-na, na-na, na-na-na, na-na, life is dynamite

Shining through the city with a little funk and soul

So I'ma light it up like dynamite, whoa oh oh

Dy-na-na-na, na-na, na-na, ayy

Light it up like dynamite

Dy-na-na-na, na-na, na-na, ayy

Light it up like dynamite

'Cause I-I-I'm in the stars tonight

So watch me bring the fire and set the night alight

Shining through the city with a little funk and soul

So I'ma light it up like dynamite (this is ah)

'Cause I-I-I'm in the stars tonight

So watch me bring the fire and set the night alight (alright, oh)

Shining through the city with a little funk and soul

So I'ma light it up like dynamite, whoa (light it up like dynamite)

Dy-na-na-na, na-na, na-na-na, na-na, life is dynamite

Shining through the city with a little funk and soul

Light it up like dynamite, whoa oh oh

Explanation:

Shkiper50 [21]3 years ago

5 0

La influenza es una infección viral altamente contagiosa que afecta nuestra nariz,

garganta y pulmones. ¿Cuál de los siguientes es el resultado más probable de

tratar la influenza con antibióticos? realmente no lo se

You might be interested in

Explain what happens to muscle force production at extremes of length

7nadin3 [17]

The sarcomere is the basic unit of a striated muscle and the force of a muscle is directly related to the extension that the sarcomere is under. When a sarcomere is extended from 1.5 micrometres to about 3 micrometres, the muscles' force is great and max at about 2/2.5 micrometres. When the muscle is fully extended and, therefore, the sarcomere is extended over than 3 micrometres, the muscle force decreases exponentially.

3 0

3 years ago

Question-

telo118 [61]

They are all Rr so

The entire generation will have smooth seeds.

6 0

4 years ago

Read 2 more answers

Asthma is a respiratory disorder that can cause the airways to temporarily constrict, or get narrower. Which function of the res

Lostsunrise [7]

Answer:

Explanation:

correct on edg.

3 0

3 years ago

Read 2 more answers

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

3 years ago

Read 2 more answers

3. How does your body ensure that the new cells are the same?

joja [24]

Answer:

When cells split and increase they do this very important thing in order tonmake the new cells exactly the same as the previous before them. Each cell makes more of all it's genes. Then each one.splits into two with one group of genes in each one of the new cells. During the process they make sure that all are copied correctly.

5 0

3 years ago